AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                        ----------->RAV1(2)
                                                                                       ------->TEIL
                                                                                   ------>MYB83
                                     --------->YAB1                                ------>MYB46(1)
                           <-------TEIL       ---------->DOF2                     --------->MYB52(1)
                          --------->CCA1(2)  --------->AtMYB61                   --------->TOE1(2)
                       --------->DOF5.7(1) >>>>>>>>>>MYB80                       --------->TOE2(2)
               --------->ETT(2)      <---------ICU4                             <---------MYB52(2)
               <---------ETT(2)      --------->YAB5                             --------->DEAR3(2)
               <----------ID1       <---------YAB5--------->TOE1(3)             <---------MYB55(2)
--------DOF5.7(1)    ---------->DOF2<---------ATHB12                            --------->MYB46(3)
--->ZmHOX2a(1)--------->DDF1      --------->WOX13(1)                      ------->TEIL --------->MYB52(1)
 
ctcttagcaactacaatgtcgacaaaaagatacaattcaatcatcaaaccaaagcttaacaagagaaacagaaaatgtatcgaaccaacgtacctgaaac  17211000
                                              ------>ZmHOX2a(2)
                                            <---------ARR11(3)
                                            --------->ARR11(3)
                                            --------->RVE1(2)
                                            --------->GATA12
                                            <---------GATA12                                     ---
                                    --------->ARR14(2)       <---------ARR14(2)         <---------ARR11(3)
                 --------->At4g35610<---------ARR11(2)       --------->ARR14(2)         --------->ARR11(3)
              <---------YAB1        <---------ARR14(2)       --------->RVE1(2)        <---------YAB5
              <---------YAB5        --------->GATA12         --------->GLK1(2)       <-----------GT1
            --------->YAB1          <---------GATA12     --------->YAB1            --------->AHL20(2)
    <---------ANAC58               ==================HOX2a_HOX2a                 ------>MYB83-------
    <---------ANAC58               <------ZmHOX2a(1)   --------->RVE1(2)         ------>MYB46(1) <--
 
aagaagtacttgcagtgatcatcggagagagactgagaggatttgatgatctgattcaaatcagaatccataagctcatagaccaaataaacatctctga  17211100
                                        <---------TOE2(3)    --------->TOE1(3)
                            ------>ZmHOX2a(1)  <---------ANAC58
                           --------->TOE1(3)   <---------ANAC46
    --------->TOE1(2)      --------->TOE2(3)   <---------ANAC58  ---------->DOF2
  ------->TEIL   <------NtERF2 --------->DOF5.7(1)      --------->KAN1
------>At4g35610 <---------At4g35610    <---------TOE1(3)<-------MYC3                      ---------
---->HVH21       --------->At4g35610   --------->MYB52(1)------->MYC3     <---------At4g35610
-------At4g35610----------->RAV1(1)    <---------DOF5.7(2)   --------->TOE2(3)           <---------HSFB2a(2)
 
agctgtacctgtgagtaggcagcataacatccttaagggagataacgttttcgtgtctcacatgccttaaaagcttaagctctctcaatgttctcaaagc  17211200
                          ------>ZmHOX2a(2)
                        --------->ARR14(2)
                        --------->GATA12                                        ----------->RAV1(1)
                        <---------GATA12                                       --------->ANAC58
                        <-----------ARR10                                      --------->ANAC46
                        --------->ARR11(3)                                   --------->AtMYB61
                        <---------AGP1                          <---------WOX13(1)
                        --------->ARR11(2)                     <---------WOX13(2)
                        <---------ARR11(2)                   <---------YAB1 --------->MYB46(3)
                        <---------ARR11(3)                 <-------GAMYB  --------->ANAC46
                        <---------ARR14(2)          --------->ARR11(2)  <---------KAN1      ------>ZmHOX2a(1)
     <---------GLK1(2)  <---------RVE1(2)         <---------MYB46(3)    --------->MYB46(3) <--------
->DOF2--------->GLK1(2)<---------CCA1(2)      --------->ATHB12--------->ATHB12 --------->ANAC58    -
 
atcgatgcgattctcaaacacattgtggatcttcttaatagcaactctctcattggtttcgctgttgattgaagaacaaaccacaccataagctcctctt  17211300
                                                 --------->bZIP60(2)                           <----
                                              ----------------->AGL1                           =====
                                         <---------ICU4                                       ------
                                         --------->ATHB12                                     <-----
                                        --------->ICU4                                        ------
                                        <---------YAB5           <-----------GT1              ------
      --------->KAN1                    <---------YAB1         --------->YAB5       --------------->AGL15
     <----------DOF2                   <---------TOE2(3)      <---------YAB5        <---------------AGL15
-ALFIN1   --------->YAB1              --------->YAB1          --------->ICU4   --------->KAN1 <-----
-------->ARR11(2)                    <---------KAN1 <---------ANAC46        ---------->ID1   <------ZmHOX2a(1)
 
ccaatcggcttaatcggaacatacttagtgtcgatttcgaataatgtttgccacatcgtgtagtaatgtttcccttcttgtcttatcccatttggaggat  17211400
                                                                <---------ZAT14
--ZmHOX2a(2)                                           <---------------AtSPL8
======================HOX2a_HOX2a                  --------->MYB52(1)
--->ARR11(2)                                 >>>>>>>>>MYB98--------->ZAT14                         -
----ARR11(2)              <----------DOF2   --------->MYB52(1)  --------->ZAT14   --------->YAB5  --
--->RVE1(2)          <<<<<<<<<TBF1          ------>MYB83 --------->ZAT14 <---------ANAC46         --
--->GATA12      <---------DOF5.7(1)         ------>MYB46(1)<---------ZAT14      ------------>CBF ---
----GATA12     ------>ZmHOX2a(1)          <---------MYB59<---------ZAT14 ----------->GT1   <--------
 
caactagcatcgccattcctcttcttcttctttgctaaaaaatgacctaacaaaaaacagagtacagaacagagttttgtgaaaacaattagtggaatcg  17211500
              <---------AHL12(1)
              --------->AHL12(1)                       ----------->GT1
        ----------->GT1                              --------->DOF5.7(1)    <-------MYC3
 ----------->GT1<-----------GT1                     --------->DOF5.7(1)     ------->MYC3
-------->DOF5.7(1)    <----------DOF2              ---------->DOF2         --------->ANAC46
------->DOF5.7(1)    <---------DOF5.7(1)      <---------KAN1          --------->ARR11(2)
------->DAG2 <---------AHL12(2)              --------->GLK1(2)   ---------->DOF2
------->DOF2 --------->AHL12(2)             <---------GLK1(2)--------->HSFB2a(2)
-ARR11(2)  <---------AHL20(2)            --------->ANAC46    <---------HSFB2a(2)<---------ANAC46 <--
 
aaaagggtttatagtaaattttcttctttcttctggtctaatccacagaatttgaaaagggtttatagaaaagtttccacgttgtgtttttttgtttgga  17211600
                          ------------>CBF
                        --------->LBD16
                        <---------ETT(1)
                        --------->ANAC46
                   <---------ANAC58
               <---------ANAC58
              --------->HSFB2a(1)
              --------->HSFC1(2)
              <---------ZAT2                             --------->KAN1
              --------->ZAT2                            <---------MYB52(1)           --------->ARR11(3)
        --------->GLK1(2)------>NtERF2  <---------DOF5.7(1)                          <---------ARR11(3)
   ---------->DOF2 <---------ANAC58     <---------DAG2--------->ANAC55(2)           --------->GLK1(1)
  --------->AHL20(2)   --------->HSFB2a(2)    <---------ANAC58             --------->ANAC46  <------
  <---------AHL20(2)   <---------HSFB2a(2)    <---------ANAC58 ------>ZmHOX2a(1)    <---------GLK1(1)
<-----------TBP<---------ANAC58         <----------DOF2--------->TOE2(3)   --------->ANAC58 <-------
----ZmHOX2a(1)<---------HSFC1(2)  --------->ALFIN1    <---------ANAC55(2)  --------->ANAC58 <-------
 
ggaatttaaagaatcgaagcttgcttcccgacaataagtggagctttttgctcgcttacgttattcctcttgaaaaacaagccagagaaatcttggcttt  17211700
                                                                                            --------
                <-----------GT1                                                             <-------
              <---------WOX13(2)                                                   --------->YAB1
              --------->WOX13(2)  ------------------------>ANAC81                 <---------YAB5
       --------->WOX13(1)       ---------->DOF2                 <----------DOF2   <---------YAB1
     <---------ATHB12         --------------->AGL15             <---------DAG2  <---------ICU4
     ------------>CBF         <---------------AGL15     --------->DAG2         --------->ICU4
----DOF2     <---------ICU4  ----------------->AGL1    ---------->DOF2         <---------YAB1  -----
--ANAC58  --------->TOE2(3)  ----------------->AGL2  --------->ARR11(3)      --------->YAB5 --------
--ANAC58  --------->YAB1--------->YAB5--------->At4g35610----------->GT1    <---------YAB5  --------
 
acttagctatcaatcttaattactagacgactaccaaaagcagaagaagagaagaagataaagtaaacttttttcaagagtcattatcatcaaacactta  17211800
                                                                           <---------TOE2(3)
      --------->ZAT14                                     --------->DOF5.7(2)
      <---------ZAT14                         --------->TOE2(3)         <---------YAB1
 <---------KAN1                              ----------->GT1           <---------AHL20(3)
->ANAC55(1)                                 <---------YAB5<---------MYB52(1)  <---------GATA12
--ANAC55(2)                     ---------->DOF2        ---------->ID1  --------->AHL20(3)
---->MYB52(1)                --------->YAB1--------->ARR14(2)        --------->ICU4                -
->ANAC55(2)            ------>MYB46(1)     --------->GLK1(2)         <---------YAB1        ---------
->ANAC46               ------>MYB83       <---------GLK1(2)     --------->LBD16<------ZmHOX2a(2) ---
 
acgaattagtaaactagcaaaaaaccaaacaaaaataaagtctcagaatcgtcaattcgtcgttatccagagattattatggatcagataagtacaaagg  17211900
<- Previous    Next ->

AGI:  At4g36450.1   
Description:  ATMPK14 (MITOGEN-ACTIVATED PROTEIN KINASE 14); MAP kinase/ kinase. Identical to Mitogen-activated protein kinase 14 (MPK14) [Arabidopsis Thaliana] (GB:O23236); similar to ATMPK7 (MAP KINASE 7), MAP kinase/ kinase [Arabidopsis thaliana] (TAIR:AT2G18170.1); similar to double HA-tagged mitogen activated protein kinase 14 [synthetic construct] (GB:ABG54341.1); similar to double HA-tagged mitogen activated protein kinase 7 [synthetic construct] (GB:ABG54334.1); contains InterPro domain Serine/threonine protein kinase; (InterPro:IPR002290); contains InterPro domain Protein kinase, core; (InterPro:IPR000719); contains InterPro domain Protein kinase
Range:  from: 17210248    to: 17211416    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version