AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                ----------->GT1
                                --------->ANAC55(2)
                                --------->ANAC58
                                --------->ANAC58
                                <---------ANAC55(2)
                           <---------TOE1(3)
                           <---------TOE2(3)
                     --------------->AGL15
             <--------P--------->WOX13(2)          --------->KAN1
      --------->MYB46(3)  ---------->DOF2         <---------AHL12(1)           <---------KAN1
  <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)          <---------AHL20(3)       <---------------------WRI1
 --------->At5g28300 <---------------AGL15       --------->AHL12(2)    <---------At5g28300
-----NtERF2 <xxxxxxxxxxxxxxxxsmallRNA(s)--------->ZAT6             --------->AHL12(2)
--------At4g35610    ------>ZmHOX2a(1)<-----------GT1             <---------KAN1
------->At4g35610 xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)     --------->RVE1(2) --------->RVE1(2)
--->PCF2xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)    <---------AHL12(2)--------->YAB1                <--
>NtERF2 <---------LBD16<---------WOX13(2)        --------->AHL20(3)<---------AHL12(2)           ----
 
ccgctgtaaaccacgggttgaatcctagttaaagtaagtaataactctccaaaattatcccaaaatcgaatattaactgcgaatcaaactaaaaacaaga  2674700
                                                <---------AHL20(2)
                                               --------->AHL20(3)
                                               --------->AHL20(2)
                                               <---------AHL20(2)
                                               <---------AHL20(3)
                                              <---------AHL12(2)
                                              --------->AHL12(2)
                                             --------->AHL20(3)
                                             <---------AHL12(3)
                                             <---------AHL20(3)
                                             <---------AHL25(2)
                                             --------->AHL25(2)
                                             <---------AHL12(2)
                                            <---------AHL25(3)
                                            <---------AHL12(1)
                                            <---------AHL25(2)
                                            --------->AHL12(1)
                                            --------->AHL25(2)
                                            <---------AHL25(1)
                                            --------->AHL20(2)
                                            --------->AHL12(3)
                                            <---------AHL12(3)
                                            --------->AHL25(1)
                                           --------->AHL12(1)
                                           <---------AHL12(1)
                                           <---------AHL25(2)
                                           <---------AHL12(3)
                                           --------->AHL12(3)
                                           --------->AHL20(2)
                                           <---------AHL25(3)
                                           <---------AHL20(2)
                                           --------->AHL25(1)
                                           --------->AHL25(3)
                                           --------->AHL25(2)                                      <
                                           <---------AHL25(1)                                   <---
                                          --------->AHL20(3)                                <-------
                                          --------->AHL12(3)                                <-------
                                          <---------AHL12(3)                                <-------
                                          <---------AHL12(2)                                --------
                                          --------->AHL12(2)                                --------
                                          --------->AHL25(3)                                --------
                                          --------->AHL25(2)        --------->AHL20(2)     ---------
                                          <---------AHL25(2)      <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
                                          <---------AHL20(3)     --------->TOE1(3)         ---------
                                         <---------AHL12(2)      --------->YAB1          <---------AHL12(2)
                                         --------->AHL12(2)      --------->TOE2(3)       --------->AHL12(2)
                                  ---------->DOF2             <-----------GT1            <---------AHL20(3)
                         <-----------GT1 --------->YAB1   <---------ARR11(3)             --------->AHL20(3)
-------KAN1<-----------GT1       --------->AHL20(2)       <---------GATA12             <---------WOX13(1)
----->GLK1(2)        --------->AHL20(2)>>>>>>>>>>GT-3b    --------->ARR11(3)        <---------YAB1 <
 
atttgaaacttttaaaacccttcattttatacaaaataaaagaaaaataattttataaaaagatttaaccataaaatagaaaccaatttgattaatatct  2674800
                      --------->WOX13(2)
                    <---------AHL12(3)
                    --------->AHL25(1)
                    <---------AHL20(2)
                    <---------AHL25(3)
                    <---------AHL12(1)
                    --------->AHL12(1)
                    --------->AHL12(3)
                    --------->AHL20(2)
                   --------->AHL12(3)
                   --------->AHL20(1)
                   --------->AHL25(1)
                   <---------AHL20(3)
                   --------->AHL20(3)
                   <---------AHL20(1)
                   --------->AHL25(3)
                   <---------AHL25(2)
                   --------->AHL20(2)
                   <---------AHL20(2)
                   <---------AHL25(1)
     <-----------GT1<---------AHL25(1)
<---------DOF5.7(1)--------->AHL25(2)
----------DOF2     <---------AHL25(3)    --------->ANAC58
--------GT1        --------->AHL12(1)    --------->ANAC46
--AHL20(1)         <---------AHL12(1)    --------->ANAC55(2)
----ARR10         <---------AHL12(2)     --------->ANAC58            --------->WOX13(2)
--ARR11(3)        --------->AHL12(2)     <---------ANAC55(2)    <---------ZAT6
->AHL20(1)       --------->AHL12(2)      --------->AtLEC2 --------->ZAT6
->ARR11(3)       --------->WOX13(2)  <-----------HVH21    --------->YAB5
->RVE1(2)        <---------WOX13(2)--------->DOF5.7(1)  --------->RVE1(2)
>RVE1(1)        --------->AHL20(2) --------->DAG2       <---------ARR11(3)
>CCA1(1)<----------DOF2      ----------->RAV1(1)       <---------KAN1<---------WOX13(2)  <---------WOX13(2)
---------DAG2   --------->ATHB51  ---------->DOF2     ---------->TaMYB80 ------->TEIL    --------->WOX13(2)
 
tacttttttttctttcccataatttatttagccaacaaaaagtcacgcaaaatatggaatatcactagtgttaatggaccgagttttaagtcaattggct  2674900
                                   <---------AHL20(3)
                                  --------->TOE2(3)
                                  <---------AHL12(2)
                                  --------->AHL12(2)
                               --------->AHL12(2)
                             --------->AHL20(2)
                             <---------AHL25(1)
                             --------->AHL25(1)
                             <---------AHL25(3)
                             <---------AHL20(2)
                             --------->AHL20(3)
                             <---------AHL12(3)
                             --------->AHL12(3)
                         --------->AHL20(3)
                         --------->AHL12(1)
                         <---------AHL12(1)
                         <--------ATHB1
                         --------->ATHB51
                         <---------AHL25(2)
                         --------->AHL20(2)
                         <---------AHL25(3)
                         <---------ICU4
                         <---------AHL20(2)
                         --------->AHL25(2)
                         <---------AHL25(1)
                         --------->AHL25(1)
                         <---------AHL20(3)
                        --------->ICU4
                        --------->AHL25(3)
                        <---------YAB1
                       --------->AHL20(3)
                       --------->AHL12(2)
                       <---------AHL20(3)
                       <---------AHL12(3)
                       <---------AHL25(2)
                       --------->AHL25(2)
                       --------->AHL12(3)
                       <---------AHL12(2)
                      <---------ICU4
                      --------->YAB1
                     <---------YAB1<---------AHL12(3)
                     --------->ICU4<---------AHL20(2)
                    --------->AHL25(2)
                    <---------AHL25(2)
                    --------->AHL20(3)
                    <---------AHL20(3)                          --------->ATHB12
                   --------->YAB1<---------AHL12(1)          --------->YAB1
                  <---------AHL20(2)  --------->WOX13(2)     --------->YAB5           --------->WOX13(2)
                 --------->AHL20(2)<---------YAB1   ----------->GT1                   <---------WOX13(2)
              --------->AHL20(2) --------->AHL12(1)<---------TOE2(3)            --------->MYB59    <
            <----------DOF2  --------->AHL25(3)   --------->MYB52(1)      ---------->DOF2  <--------
        <---------ARR11(2)<---------AHL12(2)      <-----------GT1       ----------->HVH21  <--------
 
caaatggagcctatactttatataataataatttaaatattaatggacaagagtaacgttacaatgttgatgggcctgaaagttaagtcaattggcctga  2675000
                                                            <---------YAB1
                                                           --------->AHL20(2)
                                                           --------->AHL20(3)
                                                           <---------AHL20(3)
                                                           <---------AHL25(2)
                                                           <---------AHL25(1)
                                                           --------->AHL25(2)
                                                           <---------AHL20(2)
                                                          --------->YAB1
                                                         <---------YAB1
                    --------->YAB5                      --------->AHL20(3)
                   --------->DOF5.7(1)                  <---------AHL20(3)
           <------ZmHOX2a(1)                            --------->AHL25(2)
          ----------->GT1                               <---------AHL25(2)
    <-----------ARR10   <------------CBF                --------->AHL20(2)         ------------>CBF
    --------->GLK1(2) <---------YAB1                  <---------YAB1           ----------->GT1
    --------->RVE1(2)<---------GLK1(2)             --------->AHL20(2)         <---------TOE2(3)
---------KAN1    ---------->DOF2                 ----------->GT1             --------->MYB52(1)
-ANAC58  <---------TOE1(3)                     ---------->DOF2               <-----------GT1      *TSS
-ANAC58  <---------TOE2(3)                   ----------->HVH21      <------ZmHOX2a(1)   <---------ICU4
 
gagtaagtatctaaggaaaaaaaagattattgtttaatgctgatgggcctgaaagttaatattataatcgaggagaagagtaacgttacaattttgacaa  2675100
        =====================================HOX2a_HOX2a
        ------>ZmHOX2a(2)
       <------ZmHOX2a(2)                                                                       -----
      <---------GATA12                                                               <------ZmHOX2a(1)
      --------->ARR14(2)                                                            ----------->GT1
      --------->GATA12                                                       <---------------AGL15
      --------->RVE1(2)                                                      --------------->AGL15
      <---------ARR14(2)                                               --------->GATA12    ---------
      <---------ARR11(2)                                               <---------ARR11(3)  ---------
      --------->ARR11(2)                                               --------->RVE1(2)  --------->DAG2
    --------->DEAR3(1)                 <---------DOF5.7(1)             --------->ARR11(3)---------->DOF2
  --------->LBD16                  <---------ATERF1(1)           --------->TOE2(3)  <----------ID1
  ------>NtERF2                ------->GAMYB               ------>ZmHOX2a(1)--------->ANAC46   -----
  <------NtERF2    --------->AHL12(1) ------>ZmHOX2a(1)------>ZmHOX2a(1)    <-----------------AGL1
  <---------At4g35610    --------->ANAC46------>ZmHOX2a(1)--------->TOE2(3) <-----------------AG
--------->ZAT18    --------->KAN1 --------->ARR14(2)------>ZmHOX2a(1)  <-----------ARR10 --------->DOF5.7(1)
--------->SPL7(1)  <---------AHL12(1)<---------ALFIN1<---------DOF5.7(1)    ----------------->AGL1
 
gagtccgccgatctgttttcaaatattcaaacaacaggctcctccttcttccttcctccttcctcaattcttaaaatctcccccattaggaaaaaagcaa  2675200
                                                                            <---------LBD16
                                                                           <---------LBD16
                                                                          ------>ZmHOX2a(2)
                                                                         <------ZmHOX2a(2)
                                                                         ===========================
                                                                        <---------GATA12
                                                                        --------->ARR14(2)
                                                                        --------->GATA12
                                                                        <---------ARR11(2)
                                                                        --------->ARR11(2)
                                                                        <---------ARR14(2)
                                                                      --------->DEAR3(1)
                                                                     <------NtERF2
                                                                    <---------ATERF1(1)
                                                                    ------>NtERF2
                                                                    --------->ABI4(1)
                                                                    --------->LBD16
                                                                   --------->RRTF1(3)
                                                                   <---------DEAR3(1)
                                                                   --------->RRTF1(2)
                                                                   --------->RAP2.3(2)
                                                                   --------->DEAR3(1)
                                                                   <---------ATERF1(2)
                                                                   --------->ATERF1(2)
                                                                   --------->RAP2.6(2)
                                                                   --------->RAP2.3(3)
                                                                  --------->RAP2.6(1)
                                                                  --------->RAP2.3(1)
                                                                  --------->ERF1
                                                                  --------->ATERF1(1)
                                                                  --------->RRTF1(1)            ----
                                                                  --------->ORA47(2)          ------
                                                                  --------->DEAR4(2)         <------ZmHOX2a(2)
                                                                 ------>NtERF2              <-------
                                                                 --------->At4g35610        --------
                                                             <---------ARR14(2)             <-------
                                                             --------->ARR14(2)             <-------
                    <-------TEIL                --------->LBD16  --------->LBD16            --------
                  --------->GATA12              <---------TOE1(2)<---------ATERF1(1)        --------
    --------->WOX13(2)            --------->GATA12           <---------GATA12               <-------
    <---------WOX13(2)     --------->DOF5.7(1) --------->LBD16  --------->ANAC46       --------->CCA1(2)
--------->TOE2(3) <---------GATA12<---------GATA12           --------->ARR11(2)       <---------RVE1(2)
---->ANAC58       <---------ARR14(2)          <---------LBD16--------->GATA12         <---------GATA12
>ANAC58           --------->ARR14(2)         <---------LBD16--------->GLK1(1)         --------->GATA12
>ANAC58<-----------GT1----------->GT1   --------->GLK1(1)   --------->KAN1==========================
---->ANAC58       <---------GLK1(2)     <---------GLK1(1)   <---------GLK1(1)       <---------TOE2(3)
 
gaaccctaatttcccatctcagattcagaaaaaaccaggtctgatttctcccgggttcttaagaaatccgccgccgatctcgggattgagatttggatcc  2675300
     ------->TEIL
===HOX2a_HOX2a
-->ZmHOX2a(1)
>ZmHOX2a(2)                                                 <---------DAG2
--ARR14(2)                                        --------->GLK1(2)
->GATA12                                         --------->ARR14(2)
--ARR11(2)         --------->WOX13(1)   --------->ANAC46    <---------DOF5.7(1)
--GATA12        --------->ANAC58     --------->O2<---------ARR14(2)                         <-------
->ARR11(2)   --------->ALFIN1 --------->HSFB2a(1)<---------GLK1(2)                         <--------
->ARR14(2)   <---------REM1(1)<---------KAN1  --------->YAB1<----------DOF2       --------->ANAC58
--RVE1(2) --------->DAG2      --------->KAN1-------->P     <---------DOF5.7(1)    --------->ANAC58<-
===HOX2a_HOX2a  --------->ANAC58     <---------O2--------->ARR11(2)            <---------SPL7(1)<---
 
tattgacgagcctaaggtgaagcaatccatcgaagatgccacttcgcaaccagaatcgcgctcctttacctagtccaaacgtcgtaagccttcttctttc  2675400
                                                                                                  --
                                                               <---------YAB5                    <--
                                                              --------->WOX13(2)                <---
                                                            <---------AHL20(2)                  <---
                                                     <-----------GT1                            ----
                                                  --------->AHL20(3)                            <---
                                                  <---------AHL12(2)                            ----
                                                  <---------AHL20(3)                            <---
                                                <---------RVE1(1)                               ----
                                                <---------CCA1(1)                               <---
                                               --------->ARR11(3)          <---------TOE2(3)    <---
   <-----------GT1                         --------->MYB52(1) <---------WOX13(2)                <---
---DOF2                                 --------->YAB1      <---------AHL25(1)                  ----
-DOF5.7(1)                         ---------->DOF2--------->AHL12(2)       <---------TOE1(3)  ------
--------AHL20(2)               ----------->GT1 <---------ARR11(3)     <---------RVE1(2)--------->WOX13(2)
-------DOF2            --------->At4g35610--------->ICU4    --------->AHL20(2)         <---------WOX13(2)
 
ttttattttccttcttctaagagagaagcggagattgtaaaagtcataacgatatttttcagtttaattgtttgatttagggttttgttcaattgagaag  2675500
  <---------ANAC46
---->ZmHOX2a(2)
----ZmHOX2a(2)
------AGP1
------ARR11(3)
----->ARR14(3)
------RVE1(2)                                        <-----------RAV1(1)
----->ARR11(3)                                   --------->WOX13(2)               --------->DOF5.7(1)
------ARR14(3)                                   <---------WOX13(2)              --------->DAG2
----->ARR14(2)                                 <---------AHL20(2)                --------->DOF5.7(1)
------ARR14(2)                           <----------DOF2                        ---------->DOF2
--------ARR10                      <-----------RAV1(1)   <---------MYB46(3)     --------->DOF5.7(1)
------GATA12                 ---------->DOF2 --------->ANAC55(2)       --------->YAB5    --------->ZAT18
----->GATA12             --------->YAB1 <---------ANAC58 <------MYB46(1)    <---------TOE2(3)     --
----->ARR10             <-------TEIL    <---------ANAC58 <------MYB83 <---------YAB1     <---------ZAT18
 
atcttgtgggttctcttgagaaattgattcataaaagtctgtggctttacttaattttgttggtttttgaactatgtttaagaaaaaggaagcgctctca  2675600
<- Previous    Next ->

AGI:  At4g05190.1   
Description:  ATK5 (Arabidopsis thaliana kinesin 5); microtubule motor. similar to ATK3 (ARABIDOPSIS THALIANA KINESIN 3), microtubule motor [Arabidopsis thaliana] (TAIR:AT5G54670.1); similar to ATK1 (ARABIDOPSIS THALIANA KINESIN 1), microtubule motor [Arabidopsis thaliana] (TAIR:AT4G21270.1); similar to ATK2 (ARABIDOPSIS THALIANA KINESIN 2), microtubule motor [Arabidopsis thaliana] (TAIR:AT4G27180.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO39055.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO38812.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO40263.1); contains InterPro domain Kinesin, motor region; (Int
Range:  from: 2675099    to: 2680212    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version