AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                <---------AHL20(2)
                                                                              --------->AHL12(2)
                                                                            <---------AHL20(2)
                                                                     <---------AHL20(2)
                                                                    <---------AHL20(2)
                                                                    --------->AHL25(3)
                                                        --------->RVE1(2)  <---------AHL20(2)
                                                        --------->ARR11(3)--------->AHL12(2)
                                             <----------DOF2    <---------AHL20(2)
--------->DEAR3(1)                        <-----------GT1       --------->AHL25(1)
----------->HVH21                        <-----------GT1<---------ARR11(3)<---------AHL12(2)       -
--------->MYB46(3)                     <---------AHL20(2)       --------->AHL12(3)                --
-------->At4g35610                     --------->AHL20(3)       <---------AHL25(2)                <-
---------At4g35610  <---------GLK1(1)  --------->AHL12(3)       --------->AHL25(2)       <<<<<<<<<ARR1
----->HVH21  --------->ATHB12          <---------AHL25(1)      <---------DOF5.7(1)  <-----------GT1<
--->ETT(2)  <---------YAB5             <---------AHL20(3) ------>ZmHOX2a(2)--------->AHL25(3) ------
----ETT(2)  <---------ATHB12  --------->GLK1(2)     --------->ANAC55(2)--------->AHL12(2)<<<<<<<<<ARR2
 
acagcgaccgctctaatcagtggaactctgaagtttctgtatttttatctttcttacatgatctcattttttttattttttattttttcacaatcttaca  1143600
                            ------->GAMYB
                           --------->ANAC58
                   <---------AHL12(2)
                  <---------AHL25(1)
                  <---------AHL12(1)
                  --------->AHL25(1)
                  --------->AHL12(1)
                  --------->YAB1
                  --------->AHL20(3)
                  --------->AHL20(2)
                  <---------AHL20(2)
                  --------->AHL12(3)
            --------->ANAC55(2)                                       ----------->GT1
            <---------ANAC55(2)                                     --------->DOF5.7(1)
        --------->RVE1(2)  --------->ANAC58                        --------->DOF5.7(1)
    ------>ZmHOX2a(1)      --------->ANAC46                       --------->DOF5.7(1)
------>ZmHOX2a(2) <---------AHL12(3)                              --------->DAG2
-------->GLK1(1)  <---------AHL20(3)                             ---------->DOF2
------->ARR11(3) <---------YAB5      <---------ZAT14             --------->DOF5.7(1)             <--
--------ARR11(3)--------->WOX13(2)   --------->ZAT14         <----------ID1            <---------YAB1
---------GLK1(1)<---------WOX13(2)   --------->ZAT18        ----------->GT1      <---------RVE1(2)
--->ANAC55(2) --------->AHL20(2)    ----------->HVH21     ---------->DOF2    ----------->GT1 <------
 
tgatctcctagtatcacttaattatatacaacgaaacatgtgaactggaacatagttgatagaaaggaaaaagagggaaaatgtgatttgattatagatt  1143700
                                           <---------ANAC55(2)
                                           --------->ANAC55(1)
                      --------->ALFIN1     --------->ANAC46                                  ------>ZmHOX2a(1)
      <---------TOE2(3)                    --------->ANAC55(2)                              <-------
     --------->YAB1 <---------ANAC58       --------->ANAC58--------->YAB1                  ---------
  --------->WOX13(2)<---------ANAC58       --------->ANAC58--------->AHL20(2)            --------->ARR14(2)
 --------->YAB5     <---------ANAC46      <---------LBD16  <---------AHL20(3)            <---------ARR11(2)
---------GT1    <---------RVE1(2)       <---------REM1(2) <---------KAN1                 <---------ARR14(2)
---GATA12     <---------YAB1   <----------DOF2         --------->YAB5    ---------->DOF2 --------->ARR11(2)
 
taactcattaacaatgtgtgattgtgtgtggatgctttaagtaaacacggaatagaaacgaataatatggaaactggaaagttgaaaacgcgtttcctaa  1143800
                                                                                                   <
                                                                                                  --
                                                                                                  <-
                                                                                                  --
                                                                                                 <--
                                                                                                 ---
                                                    <---------TOE2(3)                            <--
                --------->ZAT6        <---------AHL20(2)                                         ---
            --------->AHL20(2)     <---------ARR11(3)                                 <------ZmHOX2a(2)
         <---------RVE1(1)         --------->RVE1(2)--------->DOF5.7(1)              --------->ARR11(3)
        <---------RVE1(2)          --------->AHL20(1)                                <---------ARR11(3)
        <---------GLK1(2)---------->DOF2            --------->MYB59          <---------YAB1     ----
        --------->ARR11(3)--------->DAG2<-----------GT1                   ----------->GT1       <---
  ----------->HVH21      --------->DOF5.7(1)       <---------ICU4    <---------ANAC55(2)    <-------
--MYB59 <---------ARR11(3)--------->DOF5.7(1)  <---------YAB1<---------YAB5 --------->ARR11(3)------
-------->AG--------->AHL12(2)     <---------KAN1--------->YAB1--------->YAB1<---------ARR11(3)------
 
tttgtctcacagatttttaatactaaaaaaaagtggaatatataaactctataataaggtcgtaatcaaattacatgaagataatagagatcatttacca  1143900
                                                                          --------->AHL20(2)
                                                                       <---------AHL12(2)
                                                                      --------->AHL20(2)
                                                                      <---------AHL25(3)
                                                                     --------->AHL12(1)
                                                                     <---------AHL12(1)
                                                                     <---------AHL12(3)
                                                                     --------->AHL20(3)
                                                                     <---------AHL20(2)
                                                                     --------->AHL12(3)
                                                                     --------->AHL20(2)
                                                                     <---------AHL25(1)
                                                                     --------->AHL25(3)
         --------->YAB1                                              --------->AHL25(1)
--------->AHL12(1)                                                  --------->AHL12(2)
<---------AHL25(1)                                                  <---------AHL12(2)
<---------AHL20(2)                                                 <---------AHL12(2)
--------->AHL25(1)                                                <---------AHL25(3)
<---------AHL25(3)                                                --------->AHL20(2)
--------->AHL20(2)                                               <---------AHL12(3)
<---------AHL12(1)                                               <---------AHL20(2)
---------AHL12(2)        --------->ATHB12                        <---------AHL12(1)
------->AHL12(2)         -------->ATHB1                          --------->AHL20(2)
--------WOX13(2)         --------->ATHB51                        --------->AHL12(1)
------->WOX13(2)      <---------ZAT6                             --------->AHL12(3)
------HAHB4          <---------YAB1                              --------->AHL25(1)
------>YAB5        --------->YAB1                                <---------AHL25(1)
-------ICU4       --------->ICU4                                 --------->AHL25(3)       --------->ARR14(2)
------>ATHB51   --------->WOX13(1)   <----------ID1             --------->AHL12(2)        <---------ARR14(2)
----->ICU4    ------------>CBF     --------->YAB1         ----------->GT1--------->AHL20(2)<--------
------YAB1   --------->ANAC58      --------->YAB5       --------->DOF5.7(1)               --------->GLK1(2)
--At5g28300  --------->ANAC58 ------------>CBF        ---------->DOF2<---------AHL20(3)  <---------GLK1(2)
--->TOE2(3)---------->DOF2<------------CBF   --------->YAB1----------->GT1<---------AHL25(3)      *TSS
--->YAB1<---------ATHB12<---------YAB1      <---------ATHB12<------ZmHOX2a(1)        --------->At4g35610
 
taattaatctaatcaaaagcaattagtattattgacaatgacaacaaatcatcaacacaaagaggaaaataaataaataaaaaaactcagaagaatctgt  1144000
                                               <------MYB83
                                              <---------------AtSPL8
                                              --------------->AtSPL8
                                              <---------AtMYB61
                                       <-----------------AGL1
                                       ----------------->AGL1
                                      >>>>>>>>>>>>>>>>>LFY
                                   --------->KAN1
                                <---------ETT(1)
                                ----------->HVH21
                                --------->ANAC58
                                --------->ANAC58
                                --------->ANAC46                                                <---
                               --------->DEAR3(2)                                              <----
                               --------->MYB46(3) <-------TEIL                             <-------TEIL
                             <---------ARR11(2)<------MYB46(1)                           --------->GATA12
                          ------>ZmHOX2a(1)--------->ALFIN1                              --------->ARR14(2)
                          --------->HSFB2a(2)<--------P---------->DOF2                   <---------ARR14(2)
                          --------->LBD16  <-----------RAV1(1)                           <---------GLK1(2)
    --------->GLK1(1)   ----------->RAV1(2)<---------ZAT6                  <---------MYB52(1)  <----
-KAN1                   ===============================RAV         <----------DOF2     <---------TOE1(2)
 
ctcactgatttcttcatcttcttctcttcctggacccgacattccagtgttggtacataaaagactcttcctttgtctgttttttgttcccagattcatc  1144100
                                                                                            --------
                                                                                           <------NtERF2
                                                                                          <---------ATERF1(1)
                                                                                         --------->DEAR3(1)
                                                                                         <---------DEAR3(1)
                                                                                        --------->ATERF1(1)
                                                                                        <------NtERF2
                                                                                       <---------ATERF1(1)
                                                                                       <-----------HVH21
                                                                                      <---------MYB46(3)
                                                                                      <---------DEAR3(1)
                                                                                 --------->ALFIN1
                                                                               <---------bZIP60(2)
                                                                               <---------ANAC46
                                                                             ------>NtERF2------>NtERF2
                                                                =========================bZIP_DOF <-
                                                                <----------DOF2--------->O2<--------
  --------->ATHB12                                             <---------ANAC58<---------O2---------
--------->ANAC55(2)    <---------ANAC46    <---------LBD16     <---------ANAC58--------->TGA1a    <-
-------DOF2            <---------ANAC58  ----------->HVH21     <---------ANAC46<---------TGA1a   <--
-----ICU4   <---------GLK1(2) ----------->GT1    <------ZmHOX2a(1)          ----------->HVH21-------
-----DOF5.7(1)         <---------ANAC58 <-----------HVH21 <---------KAN1    --------->DEAR3(1)<-----
 
tttacttattgactaaattctctctggtgtgagaagtaaaatgggtcacggaggagaagggatgtcgcttgaattcactccgacgtgggtcgtcgccgga  1144200
                                         <---------ANAC58
       <---------WRKY38(1)               <---------ANAC58
     <-----------HVH21             <---------ANAC58
  --------->SPL7(1)                <---------ANAC58
<---------SPL7(1)                <---------ANAC46
->DEAR3(1)                    --------->ALFIN1
--------------AtSPL8         <-------GAMYB
-LBD16--------->WRKY18(1)    --------->ATERF1(1)                                       <----------DOF2
>ATERF1(1)                   <------NtERF2                                             <---------DOF5.7(1)
--------------AtSPL3        <---------MYB46(3)            <---------ZAT6               <---------DAG2
----------------SPL14      <---------DREB2C(2)      --------------->AtSPL3 --------->ANAC58
-->LBD16 <---------YAB5    <---------ANAC46         --------->MYB59        --------->ANAC58---------
-NtERF2<---------WRKY12    <---------DEAR3(1)<-----------------AGL1    >>>>>>>>>TBF1  <---------DOF5.7(1)
 
gtttgtacggtcatcgtcgcgatttcactggcggtggagcgtttgcttcactatttcggtactgttcttaagaagaagaagcaaaaacccctttacgaag  1144300
                                                                                                   <
                                                                                                   <
                                                                                                   -
                                                                                                   -
                                                                                                   -
                                                                                                   <
                                                                                                   -
                                                                                                   <
                                                                                                   -
                                                                                                   <
                        --------->ZAT14                                                           <-
                        <---------ZAT14                                                         ----
                      <---------SPL7(1)                                                         ----
                     <---------ANAC46       --------->TOE2(3)                                   ----
                     <---------ANAC58      ----------->GT1                                     -----
                    --------------->AtSPL3------>MYB83                                         <----
                --------->HSFB2a(1)     --------->AtMYB61                                  <--------
                <---------HSFB2a(1)--------->ANAC58                                        ---------
                <---------HSFC1(2) <---------ALFIN1                                        ---------
                --------->HSFC1(2) --------->ANAC58                                      <------MYB83
               <---------------AtSPL8--------->ANAC46                 <----------DOF2<---------ANAC46
               <---------------AtSPL3--------->ANAC58                <---------DOF5.7(1) <------MYB46(1)
      ----------->GT1<---------ANAC58--------->ANAC58               <---------DOF5.7(1)  <---------DEAR3(2)
     --------->DAG2 --------------->AtSPL8------>MYB46(1)         <---------DOF5.7(1)<---------ANAC58
     --------->DOF5.7(1)--------->SPL7(1)--------->MYB52(1) ---------->DOF2          <---------ANAC58
>ANAC46   ---------->DOF2          --------->ANAC46     --------->TOE2(3)  <----------DOF2<---------PCF2
 
cccttcaaaaggttaaagaaggtaccgtacacacacacacacaccaacgtaaaacaaaacatcaaaagcccttcttttctttttgtttgagtgggttcca  1144400
       <---------ANAC58
  <----------DOF2
 <---------DOF5.7(1)
 ------>ZmHOX2a(2)
<---------RVE1(1)
<------ZmHOX2a(2)
---------RVE1(2)
---------GATA12
-------->GATA12
-------->ARR11(3)
------>TEIL
---------ARR11(3)                                              <---------YAB1
-------->ARR14(2)                                              <---------TOE1(3)
---------ARR11(2)                                              <---------TOE2(3)
-------->ARR11(2)                                            -------->HAHB4
---------ARR14(2)                                            <---------ICU4
--------CCA1(2)                                              --------->YAB1      <---------ARR14(2)
----->ANAC46                                                <---------ATHB51     --------->ARR14(2)
----->ANAC58                                                <---------YAB5       <---------ARR11(3)
----->ANAC58                                                --------->ICU4       --------->ARR11(3)
---->LBD16                                                 <---------WOX13(2)    --------->GLK1(2)
-----LBD16                                                 --------->WOX13(2)    --------->RVE1(2)
-ARR11(2)                                                <---------AHL20(2)      --------->GATA12
>PCF2  <---------ANAC58                                  --------->AHL20(2)      <---------GATA12
>ARR11(2)                   <---------LBD16           <----------DOF2   --------->WOX13(2)
 
cggatcttttgagtgagattagttttgtttttctgggttataacacagtgttttagtcttttaattatggtttctagtttacaaaatctgcaaattgttc  1144500
<- Previous    Next ->

AGI:  At4g02600.1   
Description:  ATMLO1/MLO1 (MILDEW RESISTANCE LOCUS O 1); calmodulin binding. Identical to MLO-like protein 1 (MLO1) [Arabidopsis Thaliana] (GB:O49621;GB:O22766); similar to MLO15 (MILDEW RESISTANCE LOCUS O 15), calmodulin binding [Arabidopsis thaliana] (TAIR:AT2G44110.2); similar to MLO15 (MILDEW RESISTANCE LOCUS O 15), calmodulin binding [Arabidopsis thaliana] (TAIR:AT2G44110.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO46388.1); similar to barley mlo defense gene homolog8 [Zea mays] (GB:NP_001105171.1); similar to unknown [Populus trichocarpa x Populus deltoides] (GB:ABK96389.1); contains InterPro domain Mlo-related protein; (InterPro:
Range:  from: 1143999    to: 1147409    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version