AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                                   -
                                                                                                  ==
                                                                                                  <-
                                                                                                 <--
                                                                                                 ---
                                                                                                 <--
                                                                                                 ---
                                                                                                 ---
                                                                                                 <--
                                                                                               -----
                                                                                            <------ZmHOX2a(2)
                                                                                           ---------
                                                                                           <--------
                                                                                           <--------
                                                                                         <---------KAN1
                                                                                         --------->HSFB2a(1)
                                                                                         --------->HSFC1(2)
                                                                                         <---------HSFB2a(1)
                                      <------ZmHOX2a(1)                                 --------->SPL7(1)
                                  --------->TOE1(2)                                    --------->MYB52(1)
                                 -------->ZAP1                                         ------>MYB83=
                               <---------WRKY18(1)                                     ------>MYB46(1)
                        --------->GLK1(1)                                           --------------->AtSPL3
               --------->DAG2 --------->WRKY12                                    --------->ARR14(2)
         <---------ANAC46   <---------ANAC58         <---------ZAT18              --------->ARR11(2)
      --------->ALFIN1  <---------GLK1(1)<---------GATA12          --------->ARR11(3)<---------MYB52(2)
------TOE1(3) ---------->DOF2 ----------->HVH21    <---------At4g35610            <---------ARR14(2)
------TOE2(3)<---------KAN1 <---------ANAC58       --------->At4g35610            <---------ARR11(2)
 
aggtttgaagtggagcataaagctagggtttccttgacctaggagattgaattcagcgctcatgagcatagagcttgaaatcggagaaccgaacgatccc  21482100
 --------->LBD16
----->ZmHOX2a(2)
===============================HOX2a_HOX2a                                       --------->DAG2
-----ZmHOX2a(2)                                                                 ---------->DOF2
-------GATA12                                                             <-------TEIL
------>GATA12                                                           <---------GATA12
-------ARR11(2)                                                         --------->ARR14(2)
------>ARR11(2)                   ------->TEIL                          <---------GLK1(2)
------>ARR14(2)                --------->ANAC58                         --------->GATA12
-------ARR14(2)                --------->ANAC58                         <---------ARR11(2)
---->LBD16          ---------->DOF2<---------YAB5      <----------DOF2  --------->ARR11(2)
>ARR14(2) --------->YAB5       --------->ANAC46  --------->ANAC58       <---------ARR14(2)
-ARR14(2)<---------YAB1 <------ZmHOX2a(1)        --------->ANAC58      --------->KAN1
-GATA12 <---------TOE2(3)     --------->LBD16 --------->At5g28300     ----------->ARR10
===============================HOX2a_HOX2a <---------ORA47(1)   --------->DOF5.7(1) --------->ALFIN1
 
gatccggttttgacgattagagagaaaggattccacgaatcgtttggacggtaagcgactttgagagaagggccagattcgaagaaagtggagagattga  21482200
                        --------->YAB5
                    --------->DEAR3(1)
                    <---------DEAR3(1)
                    ----------->HVH21
                  <---------ATERF1(1)
                  --------->LBD16
                  ------>NtERF2
                 <---------DEAR3(1)
           <---------RVE1(2)
           --------->GATA12
           --------->ARR11(2)
           <---------ARR14(2)                  --------->TOE1(2)
           --------->ARR14(2)                  --------->TOE2(3)
           <---------GLK1(2)            ----------->GT1
        <---------TOE1(2)        <---------WOX13(1)                                              ---
      <---------ANAC46  --------->HSFB2a(1)    --------->TOE2(2)                                 ---
      --------------------->WRI1--------->GATA12                                                 ---
  <---------ZAT2<---------LBD16 <---------GATA12                               --------->DOF5.7(1)
  --------->GLK1(1)--------->ATERF1(1) ----------->GT1            <----------DOF2    <----------DOF2
  <---------At4g35610 <------NtERF2   --------->DOF5.7(1) ---------->DOF2    ---------->DOF2  <-----
  --------->At4g35610------>NtERF2  ---------->DOF2   --------->YAB5         --------->DOF5.7(1) ---
 
gactgagctccttggattctccggcgacgattccagattgaaagggtaaacctaagatgcttaaaggaactttagccctaaaaagaggcttttgctcttc  21482300
                                           --------->YAB1
                                          <---------ATHB12        <---------ANAC46
 --------->HSFC1(2)                    --------->YAB5            <---------LBD16              ------
------>ANAC55(2)              ------>NtERF2--------->ATHB51     --------->MYB52(1)            <-----
------>ANAC46                --------->ANAC46                  <---------SPL7(1)             <------ZmHOX2a(1)
------>ANAC58                --------->ANAC58                 <---------ANAC58 --------->ALFIN1
----REM1(2) ------>NtERF2    --------->ANAC58                 <---------ANAC58 <---------AtMYB61
------>ANAC58    --------->REM1(1)   --------->RVE1(2)       --------->At4g35610<---------MYB46(3)
 
acgaaacttcatcgatgccttcatcttcttctacgcccaaaatcaataatcgaattcagcaagtagcttacggagagtaccagtggtcgagtagaaggat  21482400
                                                                            <------MYB46(1)
                                                                          <--------P
                                                                        <---------MYB46(3)
                                                                       <---------YAB1
                                                                   <---------GLK1(2)             ---
                       ----------->GT1                             <---------RVE1(2)            ----
                      <---------TOE2(3)                          <---------YAB5                 <---
                    ---------->DOF2                              --------->ICU4                 <---
                   <---------AHL20(2)<---------DOF5.7(1)      *TSS <---------ARR11(3)     --------->DOF5.7(1)
           --------->WOX13(2)       <---------DOF5.7(1)     <---------ANAC46<------MYB83 --------->DOF5.7(1)
           <---------WOX13(2) <-----------GT1   --------->ARR11(3) --------->ARR11(3)<------ZmHOX2a(1)
--->ARR14(2)    <---------WOX13(2)  <----------DOF2       ----------->GT1<-------GAMYB <---------KAN1
----ARR14(2)    --------->WOX13(2)  <---------DAG2    <------ZmHOX2a(1)<---------TOE2(3)---------->DOF2
 
ttgtatgagttttaaactaaatttaaaggaaaatttccacttttttcttaagaactaggaattgtgtaaagattttggttggacatgaggataaaggctc  21482500
                                                                           <---------LBD16
                                                                        -------->HAHB4
                                                                        <---------ICU4
                                                                        --------->ATHB12
                                                                       <---------ATHB51
                                                                       <---------YAB1
                                                                       <---------YAB5
                                                                       --------->ICU4
              <---------WOX13(2)                  --------->YAB1      <---------WOX13(2)
        ---------->ID1               --------->YAB1                   --------->WOX13(2)          --
       <-----------GT1         --------->YAB1  --------->YAB1     ----------->GT1            -------
------>LBD16  --------->WOX13(2)     --------->AHL12(2)           <---------ANAC46        <---------
----->HSFB2a(2)        <---------ANAC46 --------->MYB52(1)     <---------AtMYB61--------->KAN1 -----
------HSFB2a(2)   <---------At5g28300<---------AHL12(2)      <-----------RAV1(1)--------->HSFB2a(1)
--------RAV1(2)  <-----------GT1   >>>>>>>>>>GT-3b<---------ICU4<---------ANAC46<---------HSFB2a(1)
 
cagaagtgtttttccctaatttaccctcgtgtaataagaaaaataaccgataatcaagactagtctgtggtgtaattatggggaagttccaaggcgaaaa  21482600
                                                                                       --------->ZAT14
                                                                                       <---------ZAT18
                                                                                       <---------ZAT14
     <-------GAMYB                                                                     <---------REM1(2)
    <---------MYB46(3)          --------->KAN1                                       <---------ZAT14
--------->DOF5.7(1)        --------->ZAT18                                           --------->ZAT14
------->CCA1(2)        --------->DAG2             --------->KAN1            <-----------GT1
--->DOF2   --------->YAB5 --------->ALFIN1  <---------ANAC46<------------------------ANAC81     ----
-ID1----------->GT1    --------->DOF5.7(1)<---------MYB46(3)<---------At4g35610    --------------->AtSPL8
---->DOF5.7(1)       ---------->DOF2     <--------P<-----------GT1     <---------MYB52(1)      -----
 
gataagatggttaatgcttaaaatgaaaggtggacaaatgcctggttgtttgtttatcccttctgcttctgtctgtttttttcttctctgtacacacata  21482700
         --------->AHL20(2)
         <---------AHL12(3)
         --------->AHL12(3)
        <---------AHL20(1)
        --------->AHL20(1)
        <---------AHL25(3)
       --------->AHL12(1)
       --------->AHL20(2)
       --------->AHL12(3)                       <---------ARR11(2)
       <---------AHL12(3)                       --------->ARR11(2)
       <---------AHL12(1)                      <----------DOF2
      --------->AHL12(2)                       <---------DOF5.7(1)
  --------->LBD16               --------->YAB1<---------DOF5.7(1)
 ----------->GT1                --------->AHL25(1)                                      <---------DOF5.7(1)
 --------->ANAC58               <---------AHL20(2)                        --------->ZAT18
 <---------ANAC55(2)            --------->AHL20(2)              <---------MYB52(1)  <---------TOE2(3)
 --------->ANAC58               --------->AHL12(3)            <---------ANAC58      <---------TOE1(3)
----->DAG2            ---------->DOF2   --------->DOF5.7(1)   <---------ANAC58  <----------DOF2    <
----->DOF2       --------->TOE1(3)    ---------->DOF2      <----------DOF2<---------ZAT18          -
 
aagcccgtaaatatatataagcttagaaagcccatttatattaaagaggcctttacgctgggctttcgttttgtttgtgcgcgatttagggttttttttg  21482800
                                                 --------->CCA1(2)
                                                --------->ARR11(2)
                                                <---------ARR11(2)
                                              --------->ANAC46
                                            --------->MYB52(1)
                                          <---------YAB5
                                   <---------AHL25(3)
                                   --------->AHL25(2)
                                   <---------AHL20(2)
                                   --------->AHL20(2)
                                   --------->AHL12(3)
                                   <---------AHL12(3)
                                   <---------AHL20(3)
                                   --------->AHL20(3)
                                   --------->AHL25(1)
                                  --------->AHL25(3)
                                  <---------AHL12(1)
                                  --------->AHL20(2)
                                  <---------AHL25(2)
                                  <---------AHL25(3)
                                  <---------AHL20(2)
                                  --------->AHL25(2)
        <---------DOF5.7(1)       --------->AHL12(1)
       <---------DAG2             <---------AHL20(1)                   --------->DOF5.7(1)
       <---------DOF5.7(1)        --------->AHL25(1)                 ---------->DOF2
       <----------DOF2            --------->AHL12(3)               =================================
    <---------ALFIN1              <---------AHL25(1)               <---------------AGL15   ---------
---------At4g35610  <---------ANAC58     --------->WOX13(2)    <---------DOF5.7(1)   --------->RVE1(2)
-------->At4g35610  <---------ANAC58   <---------AHL20(2)<-----------GT1  ----------->GT1---------->DOF2
 
tttgctcacactttttttttttttcttggttatctaatttttttaatcaacgatacgatttatccatcttcttaaagaggttaaacaatagcaaaagagt  21482900
                                                   <---------AHL25(3)
                                                   <---------AHL25(1)
                                                   <---------AHL20(2)
                                                   --------->AHL25(1)
                                                   <---------AHL12(3)
                                           <---------ANAC58
                                      --------->GATA12   ---------->ID1
                                  <-----------GT1 --------->AHL25(1)
                                <---------WOX13(1)--------->AHL12(1)
                            <---------ANAC46      --------->AHL25(3)
                           <---------At4g35610  --------->GATA12
                           <------NtERF2   <---------AtLEC2
                          <---------MYB46(3)    <---------GATA12      <----------DOF2
                         <---------RAP2.6(2)--------->LBD16          <---------DOF5.7(1) <----------
                       <---------MYB46(3)  <---------ANAC58   <---------DOF5.7(1)        <xxxxxxxxxx
===========================================================================MADS_MADS  ------->TEIL
>DOF5.7(1)            <---------AtMYB61    <---------ANAC46--------------->AGL15<-------TEIL xxxxxxx
 
gagaattgtgagaagttagtatttagtggtggctgatttacaatctgcgtggatttatttgtccatttttagtcttttgttgatacatgtatttactgaa  21483000
<- Previous    Next ->

AGI:  At3g57990.1   
Description:  similar to unnamed protein product [Vitis vinifera] (GB:CAO23382.1)
Range:  from: 21480979    to: 21482463    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version