AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                 -------->HAHB4
                                 <---------ICU4
                                 --------->ATHB51
                                 <--------ATHB1
                                <---------AHL20(2)
                                --------->ICU4
                                <---------YAB1
                                <---------YAB5
                               --------->AHL12(2)                                               ----
                         <---------YAB1                                                        -----
                         <---------TOE1(3)                                                   -------
                         <---------TOE2(3)                                                   -------
                       <---------ICU4                                                        <------
                      <---------YAB1                                                         -------
                      --------->ICU4                  --------->DOF5.7(1)                   --------
                    --------->YAB5<---------WOX13(2) --------->DOF5.7(1)                    --------
                    --------->YAB1--------->WOX13(2)--------->DOF5.7(1)                    <--------
                   <---------YAB1--------->ATHB12   --------->DAG2                       <----------
              <---------AHL20(2)<---------ATHB51   --------->DOF5.7(1)                <---------DOF5.7(1)
             --------->AHL20(2)<---------AHL12(2)  ---------->DOF2                   <---------DOF5.7(1)
           <---------RVE1(2) >>>>>>>>>GT-1    ----------->GT1          <----------DOF2<----------DOF2
        <---------WOX13(1)----------->GT1 --------->DOF5.7(1)      <----------DOF2  ------>ZmHOX2a(1)
 
aactacgatggattgattttatatcattatggttaataattgagtaagagagagaaaagggcgaaacttactttcttttgtagcatcctcttttaccctt  20921100
                                                                                     <---------ANAC46
                                                                                    <------NtERF2
                                                                                    --------->ATERF1(1)
                                                                                   <---------ERF1
                                                                                   <---------DEAR4(2)
                                                                                   ------>NtERF2
                                                                                   <---------ATERF1(1)
                                                                                   <---------RAP2.3(1)
                                                                                  <---------ANAC46
                                                                                  <---------RAP2.3(3)
                                                                                  <---------RRTF1(3)
                                                                                  <---------RAP2.3(2)
                                                                                  <---------DEAR3(1)
                                                                                  --------->DEAR3(1)
                                                                                 <---------ABI4(1)
                                                                                ------->GAMYB
                                                                               <---------DEAR3(1)
         <---------ICU4                                                 ------>ZmHOX2a(2)
  --------->PCF2                                                        ============================
 <---------PCF2                                                         ============================
----->MYB52(1)                <---------KAN1                            ============================
------>HVH21                 --------->ARR14(2)                        <------ZmHOX2a(2)
-->ANAC46<---------DOF5.7(1) <---------ARR14(2)                        =============================
-->TOE1(3)                   --------->GLK1(2)                         =============================
---DOF5.7(1)                <---------GLK1(2)                         --------->ARR11(3)
-->TOE2(3)<----------DOF2  <------NtERF2                              <---------GATA12
--------->AGL1            --------->LBD16             <---------ANAC55(2)    --------->MYB52(1)
------->AGL15            --------->LBD16     <------NtERF2            <---------ARR11(3)           <
---------AGL1      <---------KAN1           ------>NtERF2             --------->GATA12           ---
-GT1    <---------ATHB12<---------LBD16     <---------RAP2.6(3)      <---------GLK1(1)          <---
 
aacgggtcccaatcttttccgactatcgccggaatcttcaaacttgccgtcgttatcacatgaagcattttgagatccctcaacggcggcgagggatgag  20921200
                                                                                    --------->ARR11(2)
                                                                                    <---------ARR11(2)
                                                                                    <---------ARR14(2)
                                                                                  <---------SPL7(1)
                                                                                  ----------->HVH21
                                                                            --------->HSFB2a(2)
                                                                        ============================
                                                                        ------>ZmHOX2a(2)
                                                                      <---------ARR11(2)
                                                                      --------->AGP1--------->ARR14(2)
                                                                      --------->ARR11(2)
                                                                      <---------GLK1(2)
                                                                      <---------ARR11(3)
                                                                      --------->ARR14(2)
                                                                      <---------ARR14(2)
  <------ZmHOX2a(1)                                                   --------->ARR11(3)
===HOX2a_HOX2a                                                        <---------RVE1(2)
======HOX2a_HOX2a                                                     --------->GATA12
=========HOX2a_HOX2a                                                  <---------GATA12
======HOX2a_HOX2a                                                   ----------->ARR10 <---------LBD16
===HOX2a_HOX2a                                          <---------ARR11(3)  <---------HSFB2a(2)
------ZmHOX2a(1)         --------->MYB52(1)             --------->ARR11(3)------>ZmHOX2a(1)<--------P
------>ALFIN1  <---------TOE1(2)    <---------ZAT6    <---------TOE2(3)=============================
---ZmHOX2a(1)  <---------TOE2(2) <---------AtMYB61    ----------->ARR10<------ZmHOX2a(2)--------->LBD16
 
gaggaggagatgggttcgaaggtatcaagaacggagatggtgttattgaaacacactaagattttagccactagatcctctagaccggacccgggttgag  20921300
           --------->ZAT2                                                     --------->RVE1(2)
           <---------ZAT2                                                     <-----------GT1
           --------->At4g35610                                           <---------YAB1
           <---------At4g35610                                       <----------DOF2     --------->MYB52(2)
     --------->At4g35610                       <-------TEIL       <-----------GT1      <---------MYB52(1)
 --------->ALFIN1                           <------MYB83  <---------TOE1(3)   <---------ARR11(2)  <-
<------ZmHOX2a(1)                           <------MYB46(1)  <----------DOF2  --------->ARR11(2)<---
=======HOX2a_HOX2a                          <---------MYB46(3)<---------DOF5.7(1)    <---------MYB46(3)
=======HOX2a_HOX2a<---------MYB46(3)      <--------P  <----------DOF2<---------DAG2<---------MYB52(1)
 
agaggagttgctgaagctgagttgttaagtcatggccttcaacgagttggttcataactttaagcttttttgctttattagtatccatttgttagttttg  20921400
                                                          <---------TOE2(3)
                                                      <---------YAB1
                                                    --------->YAB5                                --
                                                    --------->ATHB12                   --------->DAG2
                                           <---------MYB46(3)                          <---------TOE2(3)
                          <-----------GT1 <---------AtMYB61*TSS--------->DOF5.7(1)     --------->DOF5.7(1)
          <---------MYB46(3)      ------>ZmHOX2a(1)<---------YAB1          <---------ANAC46---------
-----ZmHOX2a(1)          <<<<<<<<<<GT-3b<---------ANAC46---------->DOF2  --------->ALFIN1 --------->ALFIN1
------TOE2(3) ----------->GT1<----------DOF2 <---------ANAC46---------->DOF2 ----------->GT1      <-
 
aggaagtttttggtgagtggtatcttatttttctttcctcttggtgtggtttgtatgattaaaggaaagaagagaagtgtgtgtaaatataaggtggaaa  20921500
              <---------ZAT18
              --------->ZAT18
         --------->YAB1
         --------->ATHB12                   --------->AHL12(2)
         <---------ICU4                     --------->AHL25(1)
         -------->HAHB4                     <---------AHL12(3)
        <---------YAB1         <------MYB46(1)
        <---------ATHB12       <---------MYB46(3)
        --------->ICU4         <------MYB83 <---------AHL20(2)      <------ZmHOX2a(1)
<---------RVE1(2)          <-----------RAV1(1)              <---------HSFB2a(1)
--------->ARR11(3)   --------->AHL25(3)     <---------AHL25(2)  <---------ANAC46
--------->GATA12   <---------DOF5.7(1)     <---------AHL12(1) --------->CCA1(2)
--------->ARR10   <----------DOF2          --------->AHL12(1)<---------GATA12                 ------
-->GT1  <---------YAB5<---------AHL20(2) <---------RVE1(2)  --------->KAN1           --------->DOF5.7(1)
--------TOE2(3)   <---------DAG2     <----------DOF2     <------ZmHOX2a(1)         ---------->DOF2
 
taagatttgtaatgatgggcactttttattttgttggtttctttgatttttttttttagaggaagatgcgaggaaatgagaaggaagaaagagagatgtg  20921600
                                                                        <---------ANAC46
                                                                        <---------ANAC55(2)
                                                                        <---------bZIP60(2)
                                                                        <---------ANAC58
                                                                        --------->ANAC55(2)
                                                                        <---------ANAC58
                                                                     ----------->HVH21
                                                              --------->At4g35610
                                                              <---------At4g35610      <---------TGA2(1)
                                         <---------ANAC46 <---------SPL7(1)            --------->TGA2(1)
                                    <----------DOF2      <---------ANAC46       <---------YAB1
                                <---------CCA1(2)        --------->bZIP60(1) <---------ZAT6
                            --------->ANAC46         <----------DOF2 ----------->TGA1  <---------bZIP60(1)
                         --------->MYB46(3)        --------->At4g35610 ----------->STF1--------->bZIP60(1)
<------ZmHOX2a(1)      --------->RVE1(2) <---------ANAC58<---------ANAC55(2) <---------YAB5
--->ALFIN1             --------->ARR11(2)<---------ANAC58--------->ANAC55(2) --------->ICU4
 
tgaggaaatgagatggaacttgaacttatccacccatttcttttgcttatggtgagcttgacgtaagctcaaatgacgtagtgatgaatgatgtcatttc  20921700
                                  <---------GLK1(1)
                             <---------At4g35610
                        <---------AHL20(3)
                        --------->AHL20(3)
                        <---------AHL25(2)
                      --------->AHL20(2)
                      <---------AHL12(3)
                      <---------AHL20(2)
                      <---------AHL12(1)                                    <---------AHL20(2)
                      --------->AHL12(1)                                    <---------AHL25(2)
                      --------->AHL25(3)                                    --------->AHL25(1)
                      <---------AHL25(1)                                    --------->AHL12(2)
                      --------->AHL12(3)                                    <---------AHL12(3)
                      --------->AHL25(1)                                   --------->AHL25(3)
                     --------->AHL25(3)                                    --------->AHL20(2)
                  --------->AHL12(3)                                   --------->LBD16
                  <---------AHL12(3)                            <---------------AGL15
                  --------->AHL20(2)                            <---------HSFB2a(2)
                 <---------AHL20(1)                             --------->HSFB2a(2)
                 --------->ARR11(3)<---------GATA12             ====================================
                 <---------ARR11(3)--------->GATA12     <---------TOE2(3) <---------KAN1
                <---------KAN1    --------->GLK1(1) ------>ZmHOX2a(1)  ----------->GT1
            ----------->GT1  --------->At4g35610    <----------DOF2  <---------LBD16
 
atccctaagtgagaatggaatatatataattttgctgaaatccaaacttagggtcctttaatgttttctataaccggataaaatttgtatcaaaaactag  20921800
                                                                                                 <--
                                                                                                 ---
                                                                                                 <--
                                                                                                 ---
                                                                                                 <--
                                                                                                 ---
                                                                                                 <--
                                            <---------GLK1(2)                                    <--
                                    --------->AHL20(2)                                          <---
                                 --------->YAB5                                                 <---
                                <---------YAB5                                                  ----
                                --------->ICU4                                                  <---
                              ---------->DOF2--------->GLK1(2)                                  ----
             <---------YAB1  --------->AHL20(2)                                                 ----
    ---------->DOF2          <---------AHL20(2)                                                 ----
  --------->AHL20(2)     <---------------AGL15                                                  <---
  <---------AHL20(2)     --------------->AGL15                                     <---------------AtSPL3
<---------WOX13(2)      ----------------->AGL3                               ------>ZmHOX2a(1)  ----
--------->WOX13(2)    --------->RVE1(2)     <---------ARR11(3)    <---------DAG2   --------------->AtSPL8
=========================================MADS_MADS                <----------DOF2  <---------------AtSPL8
 
actaattaaaagagttatgaaaaactatccatttaaagattaaacaagattctaaatttcatttgtaaacttttttgttcctcgagattgtactaccaat  20921900
                                                 <---------GATA12
                                                 --------->ARR11(3)
                                                 --------->GATA12
                                         --------->AHL25(1)
                                         --------->AHL20(2)
                                         <---------AHL20(2)
                                         <---------AHL25(3)
                                        --------->AHL25(3)
                                        <---------AHL20(2)
            ----------->GT1            <---------AHL12(2)
         <---------REM1(1)             --------->AHL12(2)
   <-----------GT1                    --------->AHL12(2)
-------AHL25(1)                       <---------AHL12(2)
------>AHL25(1)                      <---------AHL20(2)
-------AHL25(2)                      --------->AHL20(2)
------>AHL25(2)                      <---------AHL12(3)
-------AHL25(3)                      <---------AHL25(1)
------>AHL12(3)                      --------->ATHB51
-------AHL12(3)                      --------->AHL25(1)
-------AHL20(2)                      --------->AHL12(1)
------AHL20(2)                       <---------AHL12(1)
------AHL12(1)                       <---------AHL25(3)
----->AHL20(2)                ----------->GT1   <---------GLK1(1)
------AHL20(1)        --------->At4g35610<---------AHL25(1)                     <---------YAB1
----->AHL12(1)     <------ZmHOX2a(2)<---------AHL12(1)              --------->RVE1(2)   <---------DOF5.7(1)
----->AHL25(1)    <---------ARR11(3)--------->AHL25(3)             --------->GLK1(1)   <---------MYB52(1)
----->AHL25(3)    --------->ARR11(3)<---------YAB5                 <---------GLK1(1)   <---------DOF5.7(1)
------AHL25(2)    --------->RVE1(2) --------->AHL12(1)            <---------RVE1(2) ------>ZmHOX2a(2)
----->AHL25(2)    --------->GATA12 --------->AHL12(2)  ----------->GT1        --------->CCA1(2) ----
 
ttttttttactgatgtagtaagatcagttggaatagtgaattatttatttgaaatctcgagttaaatttgatatccaaatgatatgatccgtttttctat  20922000
<- Previous    Next ->

AGI:  At3g56400.1   
Description:  WRKY70 (WRKY DNA-binding protein 70); transcription factor. Identical to Probable WRKY transcription factor 70 (WRKY70) [Arabidopsis Thaliana] (GB:Q9LY00;GB:Q8LB71); similar to WRKY54 (WRKY DNA-binding protein 54), transcription factor [Arabidopsis thaliana] (TAIR:AT2G40750.1); similar to elicitor-induced DNA-binding protein homolog [Matricaria chamomilla] (GB:BAA87069.2); contains InterPro domain DNA-binding WRKY; (InterPro:IPR003657)
Range:  from: 20919907    to: 20921460    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version