AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                    <---------GLK1(1)
                                                    --------->GLK1(1)
                                                    <------ZmHOX2a(2)
                                                   --------->GATA12                                -
                                                   --------->ARR11(3)                              -
                                                   <---------ARR14(2)                             --
                                                   <---------GATA12                               --
                                                   <---------ARR11(3)                             --
                                                <------NtERF2                                     --
                                              --------->ALFIN1                                    --
                                             -------->ABF1                                       ---
                                             ------->MYC2                                        ---
                                             <-------PIF5                                        ---
                                             ------->PIF5                                        ---
                                             <-------MYC3                                        ---
                                             <-------MYC4                                        ---
                                             <-------MYC2                                        ---
                                             ------->MYC4                                        ---
                                             ------->MYC3                                        <--
                                            >>>>>>>>>>AtMYC2                                     <--
                                            <---------TGA1a                                      ---
                                            --------->TGA1a                                     ----
              ------>ZmHOX2a(2)             <---------ANAC55(2)                                 ----
             <------ZmHOX2a(2)              <---------bZIP60(2)                                 <---
            --------->ARR14(2)              --------->ANAC55(2)                                 ----
            --------->ARR14(3)              >>>>>>>>>>ABI5                                      <---
            <---------ARR14(3)              --------->O2                                        <---
            --------->GATA12                =========================bZIP_DOF                   ----
            <---------GATA12                >>>>>>>>>>HY5                                      -----
            <---------ARR14(2)              <---------O2                                   <--------
            --------->ARR11(3)         --------->ANAC58                                <---------ANAC58
            --------->AGP1             --------->ANAC58     --------->ANAC58          --------->At4g35610
            <-----------ARR10          --------->ANAC46     --------->ANAC58   --------->ANAC46<----
            --------->RVE1(2)          ----------->HVH21  ---------->DOF2      --------->ANAC58-----
            <---------ARR11(3)        --------->SPL7(1) --------->ANAC46       --------->ANAC58<----
          ----------->ARR10         <---------SPL7(1)------>ZmHOX2a(2)    --------->At4g35610-------
  ------>ZmHOX2a(2)               --------->GATA12 --------->ARR14(2)     --------->ZAT2----------->HVH21
<---------GATA12         <---------ALFIN1   ====================================MYC_MYB<---------ANAC58
-------HSFB2a(2)       ----------->RAV1(1) ------------>OsbHLH66        ------->GAMYB <---------At4g35610
 
ctcgatcgtagacaagatcttctgtccaacactctccgatgtacgacacgtggcgatctccgaaagcaaactcaacgagctccagccattgctgaccgga  20729400
     <-------TEIL
   --------->ARR14(2)
   <---------ARR14(2)
   <---------ARR11(2)
   <---------MYB52(1)
   --------->ARR11(2)
--------->RAP2.3(1)
<------NtERF2
-------->LBD16
----->NtERF2                                                                               <-------TEIL
------->RAP2.3(2)                            <------NtERF2                                 ------>ZmHOX2a(2)
------->RAP2.3(3)                           ------>NtERF2                                 <------ZmHOX2a(2)
------->DEAR3(1)                            <---------RAP2.6(3)                           ==========
------->ATERF1(2)                          <---------ATERF1(2)                           --------->GATA12
------->RAP2.6(2)                          --------->RAP2.6(2)                           <---------GATA12
------>RRTF1(1)                            --------->RAP2.3(3)                           --------->ARR14(2)
------>DEAR4(2)                            --------->ATERF1(2)                           <---------ARR14(2)
------>RAP2.3(1)                           >>>>>>>>>AtERF-3                              --------->ARR11(2)
------>RAP2.6(1)                           --------->DEAR3(1)                            --------->RVE1(2)
------>MYB46(3)                            >>>>>>>>>AtERF-1                              <---------ARR11(2)
------>ERF1                                >>>>>>>>>AtERF-4                            <---------DEAR3(2)
------>DEAR3(2)                            >>>>>>>>>AtERF-5                         <-----------HVH21
------>ATERF1(1)                           >>>>>>>>>AtERF-2                        =================
----NtERF2                                 --------->ANAC46                        --------->DEAR3(1)
-------ABI4(2)                             --------->RAP2.3(2)                    --------->MYB46(3)
------>ORA47(2)                           --------->ERF1                          <------------AtMYB77
-->NtERF2                                 --------->RAP2.3(1)                     ==================
----->ABI4(2)                          --------->KAN1            <---------MYB52(1)------->GAMYB
------ATERF1(1)                        --------->GLK1(1)        <------MYB83<---------GATA12
----->At4g35610                        <---------GLK1(1)        <------MYB46(1)   --------->DEAR3(2)
------RAP2.3(1)                       --------->ARR11(2)       <---------MYB46(3)------>MYB46(1)
------At4g35610                       <---------ARR11(2)      <---------ANAC58   ------>MYB83
----->ZAT2                            <---------ARR14(2)      <---------ANAC58   -------->P=========
---->ARR11(2)                         --------->ARR14(2)<-----------GT1     <---------ARR11(2)    <-
-LBD16--------->KAN1              --------->LBD16    --------->AHL12(2)     <---------ARR14(2)    <-
-----ARR14(2)                     <---------At4g35610--------->AHL20(3)     --------->GLK1(2)     <-
---->ARR14(2)                    --------->ANAC46    <---------AHL20(3)    <---------GLK1(1)     <--
-----ARR11(2)                   <---------LBD16------>NtERF2  <---------ANAC46   ===================
-->LBD16                     <---------At4g35610     <---------AHL12(2)    --------->GLK1(1)--------
 
gccgccgatacgttctcttcgtagttgtcttcatctccgcagatagccgccacgatttttatctggctggtagtgagggaatccaaccgtcggatccatt  20729500
                <---------bZIP60(2)
                ============================================bZIP_DOF
                <---------TGA1a
        <---------REM1(1)
     <---------MYB46(3)
    ======================MYC_MYB
    <--------P  <---------ANAC46
   =======================MYC_MYB
   <-------GAMYB--------->TGA1a
  <---------DEAR3(2)          --------->MYB52(1)
  --------->MYB55(2)       --------->ANAC58
  <---------MYB46(3)       --------->ANAC58
 <---------ANAC46          --------->ANAC46                                                       ==
 <---------DEAR3(1)      <---------At4g35610                                                      --
------>NtERF2   <---------ANAC58                                                                  <-
<------NtERF2   =========================MYC_MYB                                                 <--
=====================HOX2a_HOX2a                  --------->DAG2                                 <--
==========================MYC_MYB                ---------->DOF2                                 ---
==========================MYC_MYB          <-----------GT1              --------->ARR11(3)       <--
=====================HOX2a_HOX2a          <---------KAN1 ------>ZmHOX2a(2)                       ---
--------RAP2.3(2)    <-----------HVH21 =========================HOX2a_HOX2a                      ---
--------DEAR3(1)<---------ANAC58       <------ZmHOX2a(1)--------->At4g35610                      ---
--------RAP2.6(2) --------->ALFIN1    --------->ICU4   --------->ARR11(3)                        <--
-------LBD16  <------ZmHOX2a(1)    --------->ALFIN1    <---------ARR11(3)                        ---
==========================MYC_MYB------->GAMYB --------->LBD16 <---------ARR11(3)               <---
->KAN1 <---------TOE2(3) --------->At4g35610 <---------LBD16   --------->ARR11(3)               ----
 
cgcggcggttgatgtaaggacgtgtgtcagaagcaacggtgaggattaaccggaaagtgatctcaagagcttgaagagctggtttgagaacgggctcgga  20729600
      ----------->GT1
   --------->ALFIN1
============================HOX2a_HOX2a
------->CCA1(2)
-----ZmHOX2a(2)
-------ARR11(3)
-------ARR11(2)
------>ARR11(3)                                         --------->DAG2           <------NtERF2
-------ARR14(2)                                        ---------->DOF2         <---------ANAC46
------>ARR11(2)                                    <---------TOE2(2)          <------NtERF2
------>ARR14(2)                               --------->MYB52(1)              <---------LBD16<------ZmHOX2a(1)
------>GATA12                             --------->ANAC46                    --------->At4g35610
-------GATA12                             --------->ANAC58                   <---------RAP2.3(1)
------>AGP1                               --------->ANAC58                  <---------DEAR3(1)  <---
------GLK1(1)                             --------->AtLEC2        --------->At4g35610     <------ZmHOX2a(1)
----->GLK1(1)        <------ZmHOX2a(1)  <-----------RAV1(2)       <---------At4g35610 --------->DOF5.7(1)
 
gatccagtgagggaaatagagagaggaccagaggtttctaagttcaggcaaacggaggtaaagctcgtaagcagagcaagcggcggaagaagaggaggag  20729700
                                                <---------ZAT2
                                                <---------At4g35610
                                                --------->At4g35610
                                          <---------TGA1a
                                          --------->TGA1a
                                          --------->O2
                                          <---------ANAC58
                                          <---------bZIP60(2)
                                          <---------ANAC46
                              <-----------RAV1(2)   <---------ANAC46
                         --------->ANAC55(1)--------->ALFIN1
                         --------->ANAC58 <---------ANAC55(1)
                         --------->ANAC58 <---------ANAC58
                         --------->ANAC46 <---------O2                            --------->RVE1(2)
                  --------->At4g35610    ----------->STF1                   --------->RVE1(2)
                  <---------At4g35610   <---------TGA2(2)                   --------->GATA12
       --------->CCA1(2)<---------LBD16----------->HVH21        <---------DOF5.7(1)
    ----------->ARR10 <---------REM1(2)----------->TGA1   <-----------GT1   <---------GATA12<-------
------GATA12  <------ZmHOX2a(1)  <------ZmHOX2a(1) <---------LBD16   ------>ZmHOX2a(1)     <--------
 
attggagaagagacggaggagagcttacacggctcaggaatggtgacgtggagcttcggagataccatcttcctctgtaaatccaaatcagccatctttt  20729800
                                    <---------AHL12(1)
                                    --------->AHL12(1)
                                    <---------AHL20(2)
                                    <---------AHL12(3)
                                    --------->AHL25(1)
                                    --------->AHL12(3)
                                   --------->AHL25(2)
                                   <---------AHL25(2)
                                   <---------AHL20(1)
                                   --------->AHL20(1)
                                   <---------AHL12(1)
                                   --------->AHL25(1)
                                   --------->AHL12(1)
                                   <---------AHL25(3)
              --------->ARR11(3)   --------->AHL25(3)
              <---------GLK1(2)    <---------ARR11(3)
              <---------ARR11(3)   --------->ARR11(3)
   --------->AHL12(3)              <---------AHL25(1)
   <---------AHL12(3)              --------->AHL20(3)
   --------->AHL25(2)              <---------AHL20(2)                           <------ZmHOX2a(1)
   --------->AHL25(1)              --------->AHL20(2)                --------->AHL25(1)
   <---------AHL20(3)              <---------AHL20(3)  --------->DOF5.7(1)  <------ZmHOX2a(1)
   --------->AHL20(2)            ------->TEIL       <------ZmHOX2a(1)<---------AHL12(3)         ----
   --------->AHL20(3)  <---------AHL20(2) <---------TOE2(3)          <-----------TBP --------->DOF5.7(1)
---DOF2       <---------RVE1(2)--------->YAB5 <---------KAN1         --------->AHL12(3)      <------
-DOF5.7(1)   <---------RVE1(1)<---------YAB1*TSS   ----------->GT1 <-----------TBP ---------->DOF2
 
ttaaaaaaaaatacagagatttttgtttatttgatgaatatatttaagaatgagaggaaaaacgtttgcgatatatataggaaggataaagagagagatg  20729900
                                 --------->KAN1
                            <-----------TGA1
                           <---------bZIP60(1)
                           --------->ANAC58
                           --------->TGA1a
                           <---------TGA1a
                           --------->ANAC55(2)
                           <---------TGA2(1)
                  --------->DOF5.7(1) --------->LBD16
                 --------->DOF5.7(1)  ----------->GT1
               ======================bZIP_DOF
               ---------->DOF2  --------->ICU4
            <------ZmHOX2a(1)--------->TGA2(2)                                             ---------
        --------->ARR14(2) ========================================bZIP_DOF              --------->MYB52(1)
        --------->ARR11(2) --------->ANAC58                                         <-------TEIL
        <---------ARR11(2) --------->bZIP60(2)                                      --------->SPL7(1)
        <---------ARR14(2) --------->O2                      <---------YAB1     --------------->AtSPL8
   --------->MYB52(1)      --------->TGA2(1)                <---------ARR11(3)  --------------->AtSPL3
  <---------ARR11(2)       <---------O2                     --------->ARR11(3) <---------DOF5.7(2)
  <---------ARR14(2)       --------->bZIP60(1)             --------->YAB1     <---------WRKY45
  --------->ARR11(2)--------->DOF5.7(1)         <---------ZAT6--------->YAB1  <---------WRKY38(1)
------->HVH21  --------->DOF5.7(1)  <---------LBD16     ---------->DOF2  ---------->DOF2--------->MYB46(3)
---GATA12 ----------->GT1 <-----------STF1 <---------WOX13(2)<------ZmHOX2a(2)<---------WRKY12 <----
 
tgaaggaaacggataggaaaaagaagggagacgtcattatgcggaaaattagagataaacaaagatcatagtttttgaaagtcaacgtacaacaacggct  20730000
                                              <---------AHL25(2)
                                              --------->AHL25(2)             --------->KAN1
       <---------DOF5.7(1)                    --------->AHL20(3)            --------->ARR11(2)
      <----------DOF2                         <---------AHL20(3)            <---------ARR11(2)
     <---------DOF5.7(1)              <----------DOF2                       <---------ARR14(2)
  ------>ZmHOX2a(1)                <-----------GT1      <---------AHL20(2)  --------->ZAT14        -
<---------ANAC58                  <<<<<<<<<<GT-3b      <---------KAN1       <---------ZAT14      <--
<---------ANAC58             --------->AHL25(3)<---------YAB1            <---------ANAC46 <---------ATHB12
>MYB46(3)                <---------DEAR3(2)   <---------AHL20(2)       <---------ANAC46 --------->WOX13(1)
-----MYB46(3)        <-----------RAV1(1)    <---------YAB1  ----------->GT1 --------->ARR14(2) -----
 
gtttcctgtcttttttgcatttttgtgtcggttttatttttctttctattattttggaataaatggaaactattttgtgtatactcgaatgcaatcagtt  20730100
                           -------->ATHB1
                           --------->AHL25(1)
                           --------->AHL12(1)
                           <---------AHL12(1)
                           --------->KAN1         ----------->GT1
                          <---------KAN1      <---------RVE1(2)
                     <------NtERF2         <---------------AGL15
    --------->ANAC55(2)   --------->ICU4   --------------->AGL15
    <---------ANAC55(2)   <---------YAB5  <---------ANAC58                  ------>ZmHOX2a(1)
   <-------TEIL     <---------MYB46(3)    <-----------------AGL2           --------->TOE2(3)
 <---------ARR11(2)<---------ANAC46       <---------ANAC58              <-----------GT1
 --------->ARR11(2)--------->ALFIN1    <----------DOF2               <---------DOF5.7(1)
-------->ANAC46 <---------YAB5      <---------ARR11(3)              <----------DOF2
---------GT1    <-----------RAV1(1) --------->ARR11(3)         --------->KAN1--------->KAN1    <----
---->KAN1     --------->MYB52(1)    --------->GLK1(2)  <---------WOX13(2)---------->ID1        <----
 
atacgatacgttttccctaatggtggggaattattcaaaaatctttcttgatatagaaaattagaaatgttcttttttccttattcgaactataagtact  20730200
                                                                                 <---------AHL20(2)
                                                                                --------->AHL20(2)
                                                                              <---------AHL12(2)  --
                                                                             --------->ATHB51     <-
                                                                             -------->ATHB1      <--
                                                                             <--------HAHB4      <--
                                                                             <---------ICU4      ---
                                                                            --------->AHL12(1)   <--
                                                                            <---------AHL12(1)   <--
                                                                            <---------YAB5       ---
                                                                            --------->AHL25(3)   ---
                                                                            <---------YAB1       ---
                                --------->DAG2                              --------->ICU4       <--
                       --------->TOE2(3)                           <---------MYB46(3)           <---
                      --------->REM1(1)                           <---------TOE1(2)             ----
                     ------>MYB83         --------->AHL12(2)     <---------MYB52(1) xxxxxxxxxxxxxxxx
                <-----------GT1---------->DOF2             --------->KAN1  <---------AHL12(2)   <---
             <---------ICU4 --------->YAB1--------->WOX13(2)   <---------MYB46(3)--------->AHL20(2)
            --------->ICU4 <---------YAB1 <---------WOX13(2)   --------->ATHB12<---------YAB1   ----
 <---------RVE1(2)   ------>MYB46(1) ----------->GT1   --------->MYB52(1)  --------->AHL12(2)   ----
 --------->ARR11(3)<---------MYB59------------>MYB.PH3(2)  --------->YAB5 <---------ICU4        ----
-----DAG2<---------YAB5--------->WOX13(2) <---------AHL12(2)<---------GLK1(2)--------->YAB5     <---
------DOF2  <---------YAB1 <---------TOE2(3)          <---------KAN1 <---------RVE1(2)          ----
 
tttggatattgtatcatttttacctacattaacataaagtttgttaataaacactggataactgattcgttggataagaattattaaaaaaaaaaaaaaa  20730300
<- Previous    Next ->

AGI:  At3g55840.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G40000.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO41329.1); contains InterPro domain Hs1pro-1, C-terminal (InterPro:IPR009743); contains InterPro domain Hs1pro-1, N-terminal (InterPro:IPR009869)
Range:  from: 20727974    to: 20729845    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version