AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                    <------ZmHOX2a(2)
                                                    <---------GLK1(1)
                                                    --------->GLK1(1)
                                                   <---------ARR11(3)                              -
                                                   --------->ARR14(2)                              -
                                                   <---------ARR14(2)                             --
                                                   --------->ARR11(3)                             --
                                                   <---------GATA12                               --
                                                <------NtERF2                                     --
                                              --------->ALFIN1                                    --
                                             ------->PIF5                                        ---
                                             <-------PIF5                                        ---
                                             <-------MYC3                                        <--
                                             <-------MYC4                                        ---
                                             -------->ABF1                                       ---
                                             <-------MYC2                                        ---
                                             ------->MYC3                                        ---
                                             ------->MYC4                                        ---
                                             ------->MYC2                                        <--
                                            >>>>>>>>>>AtMYC2                                     ---
                                            ====================================MYC_MYB          ---
                                            --------->TGA1a                                     ----
              ------>ZmHOX2a(2)             <---------TGA1a                                     ----
             <------ZmHOX2a(2)              <---------bZIP60(2)                                 <---
            --------->ARR14(2)              >>>>>>>>>>HY5                                       ----
            --------->ARR14(3)              <---------ANAC55(2)                                 <---
            <---------ARR14(3)              --------->O2                                        <---
            --------->GATA12                --------->ANAC55(2)                                 ----
            <---------GATA12                >>>>>>>>>>ABI5                                     -----
            <---------ARR14(2)              =========================bZIP_DOF              <--------
            --------->ARR11(3)         ----------->HVH21                               <---------ANAC58
            --------->AGP1             --------->ANAC58                                <---------ANAC58
            <-----------ARR10          --------->ANAC58     --------->ANAC58          <---------At4g35610
            --------->RVE1(2)          --------->ANAC46     --------->ANAC58   --------->ANAC58-----
            <---------ARR11(3)        --------->SPL7(1)   ---------->DOF2      --------->ANAC46<----
          ----------->ARR10         <---------SPL7(1)------>ZmHOX2a(2)         --------->ANAC58<----
  ------>ZmHOX2a(2)               --------->GATA12 --------->GATA12       --------->ZAT2----------->HVH21
<---------GATA12         <---------ALFIN1   <---------O2--------->ANAC46  --------->At4g35610-------
-------HSFB2a(2)       ----------->RAV1(1) ------------>OsbHLH66        ------->GAMYB --------->At4g35610
 
ctcgatcgtagacaagatcttctgtccaacactctccgatgtacgacacgtggcgatctccgaaagcaaactcaacgagctccagccattgctgaccgga  20729400
     <-------TEIL
   <---------ARR14(2)
   <---------MYB52(1)
   --------->ARR14(2)
   <---------ARR11(2)
   --------->ARR11(2)
<------NtERF2
--------->RAP2.3(1)
----->NtERF2
-------->LBD16                                                                             ------>ZmHOX2a(2)
------->RAP2.3(3)                            <------NtERF2                                 =========
------->RAP2.3(2)                           ------>NtERF2                                 ==========
------->ATERF1(2)                           <---------RAP2.6(3)                           <------ZmHOX2a(2)
------->RAP2.6(2)                          --------->ANAC46                              --------->ARR14(2)
------->DEAR3(1)                           --------->RAP2.3(3)                           --------->RVE1(2)
------>RRTF1(1)                            >>>>>>>>>AtERF-5                              --------->GATA12
------>RAP2.6(1)                           --------->RAP2.3(2)                           <---------GATA12
----NtERF2                                 <---------ATERF1(2)                           <---------ARR14(2)
------>ORA47(2)                            --------->RAP2.6(2)                           --------->ARR11(2)
------>ERF1                                --------->ATERF1(2)                           <---------ARR11(2)
------>DEAR4(2)                            >>>>>>>>>AtERF-4                            <---------DEAR3(2)
------>ATERF1(1)                           >>>>>>>>>AtERF-1                         <-----------HVH21
------>MYB46(3)                            >>>>>>>>>AtERF-3                        ------->GAMYB
-------ABI4(2)                             >>>>>>>>>AtERF-2                        =================
------>RAP2.3(1)                           --------->DEAR3(1)                     <------------AtMYB77
------>DEAR3(2)                           --------->RAP2.3(1)                     --------->MYB46(3)
----->ZAT2                                --------->ERF1                          --------->DEAR3(2)
----->ABI4(2)                          --------->GLK1(1)         <---------MYB52(1)--------->DEAR3(1)
------At4g35610                        <---------GLK1(1)        <------MYB46(1)   ==================
-->NtERF2                              --------->KAN1           <------MYB83<---------ARR14(2)
------ATERF1(1)                       --------->ARR11(2)       <---------MYB46(3)------>MYB83
------RAP2.3(1)                       <---------ARR14(2)      <---------ANAC58   ===================
----->At4g35610                       <---------ARR11(2)      <---------ANAC58   -------->P<-------TEIL
---->ARR14(2)                         --------->ARR14(2)<-----------GT1     --------->GLK1(2)
-LBD16--------->KAN1              <---------At4g35610--------->AHL12(2)     <---------ARR11(2)    <-
---->ARR11(2)                     --------->LBD16    <---------AHL12(2)     <---------GATA12      <-
-----ARR11(2)                    --------->ANAC46    <---------AHL20(3)    <---------GLK1(1)      <-
-----ARR14(2)                   <---------LBD16------>NtERF2  <---------ANAC46   ------>MYB46(1) <--
-->LBD16                     <---------At4g35610     --------->AHL20(3)    --------->GLK1(1)--------
 
gccgccgatacgttctcttcgtagttgtcttcatctccgcagatagccgccacgatttttatctggctggtagtgagggaatccaaccgtcggatccatt  20729500
                <---------ANAC46
                --------->TGA1a
                ============================================bZIP_DOF
        <---------REM1(1)
     <---------MYB46(3)
    <--------P  <---------ANAC58
    ======================MYC_MYB
   =======================MYC_MYB
   <-------GAMYB=========================MYC_MYB
  <---------MYB46(3)          --------->MYB52(1)
  <---------DEAR3(2)       --------->ANAC58
  --------->MYB55(2)       --------->ANAC58
 <---------DEAR3(1)        --------->ANAC46                                                       ==
 <---------ANAC46        <---------At4g35610                                                      <-
<------NtERF2   <---------ANAC58                                                                  --
------>NtERF2   <---------TGA1a                                                                  <--
=====================HOX2a_HOX2a                  --------->DAG2                                 ---
=====================HOX2a_HOX2a                 ---------->DOF2                                 <--
==========================MYC_MYB          <-----------GT1              --------->ARR11(3)       ---
==========================MYC_MYB         <---------KAN1 ------>ZmHOX2a(2)                       ---
==========================MYC_MYB      <------ZmHOX2a(1)--------->At4g35610                      ---
--------RAP2.6(2)    <-----------HVH21 =========================HOX2a_HOX2a                      ---
--------RAP2.3(2) --------->ALFIN1    --------->ICU4   <---------ARR11(3)                        <--
--------DEAR3(1)<---------bZIP60(2)--------->ALFIN1    --------->ARR11(3)                        <--
-------LBD16  <------ZmHOX2a(1)  ------->GAMYB --------->LBD16 --------->ARR11(3)               ----
->KAN1 <---------TOE2(3) --------->At4g35610 <---------LBD16   <---------ARR11(3)               <---
 
cgcggcggttgatgtaaggacgtgtgtcagaagcaacggtgaggattaaccggaaagtgatctcaagagcttgaagagctggtttgagaacgggctcgga  20729600
      ----------->GT1
   --------->ALFIN1
============================HOX2a_HOX2a
-----ZmHOX2a(2)
------->CCA1(2)
-------GATA12
------>ARR11(3)
-------ARR11(3)                                         --------->DAG2           <------NtERF2
------>GATA12                                          ---------->DOF2         <---------ANAC46
------>AGP1                                        <---------TOE2(2)          <------NtERF2
------>ARR11(2)                               --------->MYB52(1)              --------->At4g35610
------>ARR14(2)                           --------->ANAC58                    <---------LBD16<------ZmHOX2a(1)
-------ARR14(2)                           --------->AtLEC2                   <---------RAP2.3(1)
-------ARR11(2)                           --------->ANAC46                  <---------DEAR3(1)  <---
----->GLK1(1)                             --------->ANAC58        <---------At4g35610     <------ZmHOX2a(1)
------GLK1(1)        <------ZmHOX2a(1)  <-----------RAV1(2)       --------->At4g35610 --------->DOF5.7(1)
 
gatccagtgagggaaatagagagaggaccagaggtttctaagttcaggcaaacggaggtaaagctcgtaagcagagcaagcggcggaagaagaggaggag  20729700
                                                --------->At4g35610
                                                <---------At4g35610
                                                <---------ZAT2
                                          <---------ANAC58
                                          <---------ANAC55(1)
                                          <---------TGA1a
                                          --------->TGA1a
                                          <---------ANAC58
                                          <---------O2
                              <-----------RAV1(2)   <---------ANAC46
                         --------->ANAC58 <---------bZIP60(2)
                         --------->ANAC46 <---------ANAC46
                         --------->ANAC55(1)--------->ALFIN1
                         --------->ANAC58 --------->O2                            --------->RVE1(2)
                  --------->At4g35610    ----------->STF1                   --------->GATA12
                  <---------At4g35610   <---------TGA2(2)                   <---------GATA12
       --------->CCA1(2)<---------LBD16----------->TGA1         <---------DOF5.7(1)         <-------
    ----------->ARR10 <---------REM1(2)----------->HVH21  <-----------GT1   --------->RVE1(2)
------GATA12  <------ZmHOX2a(1)  <------ZmHOX2a(1) <---------LBD16   ------>ZmHOX2a(1)     <--------
 
attggagaagagacggaggagagcttacacggctcaggaatggtgacgtggagcttcggagataccatcttcctctgtaaatccaaatcagccatctttt  20729800
                                    --------->AHL25(1)
                                    --------->AHL12(1)
                                    <---------AHL12(1)
                                    <---------AHL12(3)
                                    --------->AHL12(3)
                                    <---------AHL20(2)
                                   --------->AHL25(1)
                                   --------->AHL25(3)
                                   --------->AHL20(1)
                                   <---------AHL20(3)
                                   <---------AHL25(1)
                                   <---------AHL25(3)
                                   --------->AHL25(2)
                                   <---------AHL25(2)
              <---------ARR11(3)   <---------AHL20(1)
              <---------RVE1(2)    --------->AHL20(3)
              <---------GLK1(2)    --------->AHL12(1)
   <---------AHL12(3)              --------->ARR11(3)
   --------->AHL25(2)              <---------AHL12(1)
   --------->AHL12(3)              --------->AHL20(2)                           <------ZmHOX2a(1)
   --------->AHL20(2)              <---------ARR11(3)                <---------AHL12(3)
   --------->AHL20(3)              <---------AHL20(2)  --------->DOF5.7(1)  <------ZmHOX2a(1)
   --------->AHL25(1)          --------->YAB5       <------ZmHOX2a(1)--------->AHL12(3)         ----
   <---------AHL20(3)  <---------AHL20(2) <---------TOE2(3)          --------->AHL25(1)      <------
---DOF2       --------->ARR11(3) ------->TEIL <---------KAN1         <-----------TBP --------->DOF5.7(1)
-DOF5.7(1)   <---------RVE1(1)<---------YAB1*TSS   ----------->GT1 <-----------TBP ---------->DOF2
 
ttaaaaaaaaatacagagatttttgtttatttgatgaatatatttaagaatgagaggaaaaacgtttgcgatatatataggaaggataaagagagagatg  20729900
                                 --------->KAN1
                            <-----------TGA1
                           ========================================bZIP_DOF
                           --------->ANAC58
                           --------->TGA1a
                           --------->ANAC55(2)
                           <---------TGA2(1)
                           --------->ANAC58
                  --------->DOF5.7(1) --------->LBD16
                 --------->DOF5.7(1)  ----------->GT1
               ---------->DOF2  --------->ICU4
               --------->DOF5.7(1)  <---------LBD16
            <------ZmHOX2a(1)--------->TGA2(2)                                             ---------
        <---------ARR14(2) --------->bZIP60(2)                                           --------->MYB52(1)
        <---------ARR11(2) --------->bZIP60(1)                                      <-------TEIL
        --------->ARR11(2) <---------O2                                             --------->SPL7(1)
        --------->ARR14(2) <---------bZIP60(1)               <---------YAB1     --------------->AtSPL3
   --------->MYB52(1)      <---------TGA1a                  --------->ARR11(3)  --------------->AtSPL8
  --------->ARR11(2)       --------->O2                     <---------ARR11(3) <---------DOF5.7(2)
  <---------ARR11(2)       --------->TGA2(1)               --------->YAB1     <---------WRKY12
  <---------ARR14(2)--------->DOF5.7(1)                 ---------->DOF2  ---------->DOF2--------->MYB46(3)
------->HVH21  ======================bZIP_DOF   <---------ZAT6--------->YAB1  <---------WRKY45 <----
---GATA12 ----------->GT1 <-----------STF1 <---------WOX13(2)<------ZmHOX2a(2)<---------WRKY38(1)
 
tgaaggaaacggataggaaaaagaagggagacgtcattatgcggaaaattagagataaacaaagatcatagtttttgaaagtcaacgtacaacaacggct  20730000
                                              --------->AHL20(3)
                                              <---------AHL25(2)             --------->KAN1
       <---------DOF5.7(1)                    <---------AHL20(3)            --------->ZAT14
      <----------DOF2                         <---------AHL20(2)            <---------ARR11(2)
     <---------DOF5.7(1)              <----------DOF2                       <---------ZAT14
  ------>ZmHOX2a(1)                <-----------GT1      <---------AHL20(2)  <---------ARR14(2)     -
<---------ANAC58                  <<<<<<<<<<GT-3b      <---------KAN1       --------->ARR11(2)   <--
<---------ANAC58             --------->AHL25(3)<---------YAB1            <---------ANAC46 <---------ATHB12
>MYB46(3)                <---------DEAR3(2)   --------->AHL25(2)       <---------ANAC46 --------->WOX13(1)
-----MYB46(3)        <-----------RAV1(1)    <---------YAB1  ----------->GT1 --------->ARR14(2) -----
 
gtttcctgtcttttttgcatttttgtgtcggttttatttttctttctattattttggaataaatggaaactattttgtgtatactcgaatgcaatcagtt  20730100
                           -------->ATHB1
                           --------->KAN1
                           --------->AHL12(1)
                           --------->AHL25(1)
                           <---------AHL12(1)     ----------->GT1
                          <---------KAN1      <---------RVE1(2)
                     <------NtERF2         --------------->AGL15
    --------->ANAC55(2)   <---------YAB5   <---------------AGL15
    <---------ANAC55(2)   --------->ICU4  <---------ANAC58                  ------>ZmHOX2a(1)
   <-------TEIL     <---------MYB46(3)    <---------ANAC58                 --------->TOE2(3)
 <---------ARR11(2)--------->ALFIN1       <-----------------AGL2        <-----------GT1
 --------->ARR11(2)<---------ANAC46    <----------DOF2               <---------DOF5.7(1)
-------->ANAC46 <-----------RAV1(1) --------->GLK1(2)               <----------DOF2
---------GT1    <---------YAB5      <---------ARR11(3)         --------->KAN1--------->KAN1    <----
---->KAN1     --------->MYB52(1)    --------->ARR11(3) <---------WOX13(2)---------->ID1        <----
 
atacgatacgttttccctaatggtggggaattattcaaaaatctttcttgatatagaaaattagaaatgttcttttttccttattcgaactataagtact  20730200
                                                                                 --------->AHL20(2)
                                                                                --------->AHL20(2)
                                                                              <---------AHL12(2)  --
                                                                             <---------ICU4       <-
                                                                             -------->ATHB1      <--
                                                                             --------->ATHB51    ---
                                                                             <--------HAHB4      ---
                                                                            --------->AHL25(3)   <--
                                                                            <---------YAB5       <--
                                                                            --------->ICU4       ---
                                                                            <---------AHL12(1)   ---
                                                                            --------->AHL12(1)   <--
                                --------->DAG2                              <---------YAB1       <--
                       --------->WOX13(2)                          <---------MYB46(3)           <---
                      --------->REM1(1)                           <---------TOE1(2)             ----
                     ------>MYB46(1)      <---------WOX13(2)     <---------MYB52(1) xxxxxxxxxxxxxxxx
                <-----------GT1---------->DOF2             --------->YAB5  --------->AHL12(2)   <---
             <---------ICU4 --------->YAB1--------->AHL12(2)   <---------MYB46(3)<---------AHL20(2)
            --------->ICU4 <---------TOE2(3)           --------->MYB52(1)  <---------AHL12(2)   ----
 --------->ARR11(3)  ------>MYB83    ----------->GT1  <---------KAN1 <---------RVE1(2)          ----
 <---------RVE1(2) <---------MYB59------------>MYB.PH3(2)  --------->KAN1 <---------ICU4        <---
------DOF2  <---------YAB1 <---------YAB1 --------->WOX13(2)   --------->ATHB12<---------YAB1   ----
-----DAG2<---------YAB5--------->TOE2(3)  <---------AHL12(2)<---------GLK1(2)--------->YAB5     ----
 
tttggatattgtatcatttttacctacattaacataaagtttgttaataaacactggataactgattcgttggataagaattattaaaaaaaaaaaaaaa  20730300
<- Previous    Next ->

AGI:  At3g55840.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G40000.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO41329.1); contains InterPro domain Hs1pro-1, C-terminal (InterPro:IPR009743); contains InterPro domain Hs1pro-1, N-terminal (InterPro:IPR009869)
Range:  from: 20727974    to: 20729845    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version