AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                       --------->YAB1
                                                                                     --------->AHL20(3)
                                                                                     <---------AHL20(3)
                                                                                     <---------YAB1
          <----------ID1                                                             --------->AHL25(2)
      --------->ANAC55(2)                                                            <---------AHL12(3)
      <---------ANAC55(2)                                                            --------->AHL20(2)
    --------->AHL20(2)                                               <---------LBD16 --------->AHL12(3)
    <---------AHL12(1)                                              <---------ANAC58 <---------AHL20(2)
    --------->AHL12(1)                                              <---------ANAC58--------->AHL12(2)
    <---------AHL20(2)                                              <---------ANAC46--------->YAB1
  --------->WOX13(2)                                            <---------DOF5.7(1)<---------KAN1
  <---------WOX13(2)       --------->CCA1(2)              <---------KAN1 <---------ARR11(2)
--------->GT1 ---------->DOF2                          <------ZmHOX2a(1) <---------RVE1(2) ---------
 
tttgtaattaagtaagacaaagaaatacagatataagatggtcgtagaaaccagtagaggaatttcatttttcgtggataagtggaatattaataagaga  4806300
                                                       --------->GLK1(2)
                                                      <---------GATA12
                                                      --------->ARR14(2)
                                                      --------->GATA12
                                                      <---------RVE1(2)                    <-------TEIL
                                                      <---------GLK1(2)                <---------AHL25(3)
                                                  <---------At4g35610                 --------->AHL25(3)
                                           <---------ICU4                             <---------AHL20(2)
                                          <---------YAB1                              --------->AHL25(1)
                --------->ALFIN1          --------->AHL25(3)                          <---------AHL12(1)
         <----------DOF2                 <---------AHL25(2)                           --------->AHL20(2)
        <---------DOF5.7(1)              <---------AHL20(3)                           <---------AHL25(1)
       <---------------AGL15             --------->AHL25(2)                           --------->AHL12(1)
       --------------->AGL15             --------->AHL20(3)                           <---------AHL12(3)
    <-----------GT1                      <---------AHL20(1)        ------->TEIL       --------->AHL12(3)
  <----------DOF2                        <---------AHL20(2)       <---------AtLEC2  --------->YAB1
 <---------DOF5.7(1)                     --------->AHL20(2)  --------->ARR14(2)--------->At4g35610 <
>DOF5.7(1) <<<<<<<<<<<<<<<<<LFY         --------->YAB1<---------ARR14(2)       ----------->GT1   <--
 
atggtctttactctttacagtgggaaatgggaatagtagcccattataatttcatcagattctatatatgcatgtttgtataagctaaaataaatacgtt  4806400
                          <---------HSFB2a(2)
                          --------->HSFC1(1)
                          >>>>>>>ZML2
                          --------->HSFB2a(2)
                          <---------HSFC1(1)
                       <---------ARR11(3)
                       --------->ARR11(3)
                 <-----------GT1
              <---------AHL12(2)
              --------->AHL12(2)
             <---------AHL25(3)
             <---------AHL12(1)
             --------->AHL12(1)
             --------->AHL12(3)
             <---------AHL12(3)
            <---------AHL20(2)
            <---------AHL12(3)
            --------->AHL20(2)                        --------->KAN1
            <---------AHL25(2)                       <---------AHL12(2)
            --------->AHL25(3)                      --------->AHL20(2)
            <---------AHL25(3)                      <---------AHL25(3)
            --------->AHL25(2)                      <---------AHL20(2)
            <---------AHL12(1)                      <---------AHL25(1)
            --------->AHL25(1)                      --------->AHL25(1)
            --------->AHL12(3)                      <---------AHL12(3)
            --------->AHL12(1)                      --------->AHL12(3)          ====================
           --------->AHL25(3)                      --------->AHL25(3)           <------ZmHOX2a(1)
           --------->AHL25(2)                    <---------WOX13(2) ----------->HVH21
           --------->AHL20(2)                 <------NtERF2         --------->ANAC46
           <---------AHL25(2)                ------>NtERF2        --------->ANAC55(2)
           --------->AHL25(1)               <---------DEAR3(1)    <---------AtLEC2---------->DOF2
           --------->AHL12(3)              --------->RAP2.6(3)<---------DAG2   --------->LBD16
---------YAB5--------->AHL25(2)           <-----------TGA1    <----------DOF2<---------LBD16
---------GT1<---------AHL25(1)      <---------DOF5.7(1)    <-----------GT1<----------DOF2   --------
 
taagcattcttcaaaaaaatttacaagttctagagactctcttaacgtcggcaatttatattctactttacatgacactttcaggaaaagaaaactatac  4806500
                    <----------DOF2
                 <-----------GT1
               <---------AHL12(1)
               --------->AHL12(1)
              --------->WOX13(2)
             --------->AHL12(2)
             <---------AHL12(2)
            <---------AHL20(2)
            --------->AHL20(2)
            <---------AHL20(1)
            --------->AHL20(3)
            --------->AHL25(1)
            <---------AHL25(3)
            --------->AHL25(3)
            --------->AHL25(2)
            <---------AHL25(1)
            <---------AHL25(2)
           --------->AHL20(2)
           --------->AHL25(3)
         <---------WOX13(2)
         --------->TOE2(3)                                                                         -
        --------->YAB5                                                                            <-
      --------->GATA12                      --------->MYB52(2)     --------->At4g35610       ------>NtERF2
      <---------ARR11(3)                 --------->TOE2(3)      <---------MYB52(1)         <--------
      --------->ARR11(3)          <---------AtLEC2      <---------AHL20(2)                 <--------
      --------->RVE1(2)    <---------DOF5.7(1)   <---------AtMYB61 <---------STY1(2)     <----------
==============HOX2a_HOX2a <----------DOF2--------->TOE1(3)<---------YAB1     <---------ZAT14 -------
->ZAT14<------ZmHOX2a(2)---------->ID1 ------->TEIL    --------->AHL25(3)    --------->ZAT14--------
 
tcactagcagatcattaaattttctttttctttttttgaatgaaccttagttgtggtttttatttttgttagctagaaacttcagtgttttttttccgcc  4806600
                                                                            --------->ANAC58
                                                                            --------->ANAC58
                                                                        ------>MYB46(1)
-------->YAB1                                                           ------>MYB83
--------ATHB12      <---------RAP2.6(2)                               --------->MYB46(3)    --------
---------AGL1      --------->SPL7(1)                                  <---------MYB59  --------->ARR14(2)
-LBD16           <---------SPL7(1)                                   --------->ANAC58  --------->ZAT14
-GT1   <----------DOF2------>NtERF2                                  --------->ANAC58  --------->ARR11(2)
-->LBD16    <---------YAB1                                         --------->GLK1(1)   <---------ARR11(2)
->ANAC46  --------->YAB1                                 ------------>CBF ---------->DOF2 --------->ANAC46
 
aatggtagtgctttgatgatggtccggcccaattcatagaaggccttgaaaatgggccagaccaattcagagacccaacaagctcgactgtatacacaaa  4806700
                                                                                  <------NtERF2
                                                                                  <---------At4g35610
                                                                                  --------->At4g35610
                                                                                  <---------ZAT2
                                                                               <---------At4g35610
                                                                               --------->ATERF1(1)
                                                                               <------NtERF2
                                                          --------->RAP2.6(2) <---------ERF1
                                                       --------->ANAC58       <---------RAP2.3(1)
                                                       --------->ANAC46       <---------ATERF1(1)
                                                  --------->RVE1(2)           ------>NtERF2
                                                 --------->GLK1(1)           <---------RAP2.6(2)
                                             <---------ANAC46                <---------RAP2.3(3)
                                     <---------DAG2  ---------->DOF2         <---------ANAC46
                                     <---------DOF5.7(1)  ----------->RAV1(1)<---------RAP2.3(2)
                                  <-----------GT1<---------KAN1              <---------DEAR3(1)
                               *TSS  --------->TOE2(3) --------->ANAC58      <---------ATERF1(2)
                              <<<<<<<<<TBF1  <---------LBD16                 --------->ATERF1(2)
                       ----------------------->TaNAC69(2)<----------ID1     --------->RAP2.6(3)
->ANAC46   <----------DOF2 <<<<<<<<<TBF1    <---------LBD16         --------->LBD16             XXXX
 
attcacaaaaacagcttttgagaagttttcttcttcttcaccttattttcgggtatcaaagccacaaaaccctgagaatggcggcagctactcaatttct  4806800
         <---------CCA1(2)
    --------->TOE2(3)       ------->GAMYB
    --------->TOE2(2)     --------->At4g35610                       <---------ANAC58
   --------->HSFB2a(1)    ------>MYB46(1)                 <---------HSFC1(2)
   <---------HSFC1(2)     ------>MYB83                    <---------HSFB2a(1)
   <---------HSFB2a(1)   --------->MYB52(1)               --------->HSFB2a(1)
   --------->HSFC1(2)   --------->AtMYB61                 --------->HSFC1(2)
   --------->MYB46(3)--------->ANAC46                    --------->ANAC58                  ---------
  ------>MYB46(1)<<<<<<<<<GATA-3      ------>MYB83       --------->ANAC58       --------->GATA12
  -------->P     <<<<<<<<<GATA-4      ------>MYB46(1)<-----------RAV1(2)        <---------GATA12
  ------>MYB83   <<<<<<<<<GATA-1    <---------MYB59  <---------HSFB2a(2)<---------CCA1(2)  ---------
 <---------ALFIN1<<<<<<<<<GATA-2    --------->AtMYB61--------->HSFB2a(2)---------->ID1     ---------
XXXXXXXXXXXXXXXX>MIR773 --------->MYB46(3)       ------->GAMYB      <---------ANAC58     ---------->DOF2
 
ctcccaaccttcgtctctcaatccacaccaactgaagaaccaaacctcacaacgctccagaagcatccctgtcttgtctcttaaatccacattgaagcca  4806900
                        <------NtERF2
                        <---------MYB52(1)
                       <-----------HVH21
                       ------>NtERF2
                      --------->DEAR3(1)
                      --------->RAP2.3(3)
                      --------->RRTF1(3)
                      --------->RAP2.3(2)
                     --------->ATERF1(1)
                     <------NtERF2
                     --------->RRTF1(1)
                     --------->DEAR4(2)
                     --------->ERF1
                     --------->RAP2.3(1)
                    ------>NtERF2
                    <---------ATERF1(1)
                   --------->RAP2.3(2)
                   --------->RAP2.6(2)                                                --------->At4g35610
              ---------->DOF2                                                       <-----------RAV1(2)
  --------->ANAC46 --------->RAP2.3(3)                                          <---------ATHB12
  --------->ANAC58 --------->DEAR3(1)                                           --------->ICU4
  --------->ANAC58--------->RAP2.3(1)                                      --------->ANAC58     <---
>ANAC58     ----------->HVH21                                   <------ZmHOX2a(2)--------->YAB1 ----
>ANAC46    --------->LBD16                         ----------->HVH21       --------->ANAC58     ====
>ANAC58   <---------ANAC46                         ----------->TGA1        --------->ANAC46 <-------
 
cttaaacgcctctccgtgaaagccgccgtcgtttctcaaaactcgtccaaaaccgtgacgaagttcgatcactgtttcaagaaatcatcagatgggtttc  4807000
                          <---------YAB1
                         --------->ARR11(3)
                        <---------GLK1(1)
                        --------->GLK1(1)
                        <---------KAN1
                       <---------ARR14(2)            <---------DOF5.7(1)     --------->ZAT14
                       <---------ARR11(3)           <----------DOF2          <------ZmHOX2a(2)
                       --------->ARR11(3)           <---------DOF5.7(1)     --------->RVE1(2)
                       --------->ARR14(2)          <---------DOF5.7(1)      --------->GATA12
                      <------ZmHOX2a(1)         <---------ARR11(3)         <---------At4g35610
                    <---------TOE2(3)  <---------ZAT14                     --------->At4g35610
              <---------TOE2(3)        --------->ZAT14                 --------->TOE1(3)
------------AGL15   <---------TOE1(3)--------->At4g35610 --------------->AGL15
----------->AGL15   <---------ANAC46 <---------At4g35610 <---------------AGL15--------->YAB5
=========================================================================MADS_MADS             <----
--GLK1(1)    ---------->DOF2      <---------YAB5--------->ARR11(3)     --------->TOE2(3) <----------
 
tctattgtgaaggaactaaagttgaggatatcatggagtcagtggagagaagacccttttacttatatagcaaacctcagatcactagaaacctcgaggc  4807100
                                      --------->ANAC58
                                      --------->ANAC58            <---------AHL20(3)
                                 <------MYB46(1)                  --------->AHL20(3)
                                 <------MYB83                     --------->AHL12(1)
                               <---------WOX13(1)                 <---------AHL12(1)
                             --------->ATHB12                     --------->AHL25(2)
                      <---------ZAT2  --------->ANAC55(2)         <---------AHL25(2)
                      <---------At4g35610                   --------->TOE2(3)
       --------->ATHB12     <---------YAB1   ---------->DOF2--------->TOE1(3)                      <
      <---------YAB5<---------ZAT18--------->ARR11(2)       --------->YAB1                         <
  --------->DOF5.7(1) --------->At4g35610   --------->YAB1 <<<<<<<<<ARR2                       <----
---------->DOF2     --------->ZAT18<---------ARR11(2)      <<<<<<<<<ARR1                       -----
-----ANAC46     <------ZmHOX2a(1)<---------MYB46(3)   <-----------GT1                          <----
-----------WRI1--------->DOF5.7(1) --------->ARR14(2) --------->YAB1                     <---------TOE2(3)
 
ttataaagaagcattggaaggagtgagctctgtgattggttacgctatcaaagctaataacaatcttaaaattttggagcatttgagaagtttaggctgt  4807200
<- Previous    Next ->

AGI:  At3g14390.1   
Description:  diaminopimelate decarboxylase, putative / DAP carboxylase, putative. Identical to Diaminopimelate decarboxylase 1, chloroplast precursor (LYSA1) [Arabidopsis Thaliana] (GB:Q949X7;GB:Q9LUL0); similar to diaminopimelate decarboxylase, putative / DAP carboxylase, putative [Arabidopsis thaliana] (TAIR:AT5G11880.1); similar to Os02g0440000 [Oryza sativa (japonica cultivar-group)] (GB:NP_001046744.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO45513.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO47588.1); contains InterPro domain Diaminopimelate decarboxylase; (InterPro:IPR002986); contains InterPro domain Orn/DAP/A
Range:  from: 4806732    to: 4809440    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version