AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
          --------->ZAT18
          <---------ZAT18
        --------->PCF2
        ---------->ID1
  <---------YAB1
  <---------AHL12(3)
  <---------AHL12(2)
 <---------ARR11(3)
 <---------AHL25(3)
 --------->AHL12(2)
 <---------AHL12(1)
 --------->AHL12(1)
 --------->ARR11(3)
 <---------AHL12(2)
 <---------AHL25(2)
 <---------AHL20(1)
 --------->AHL25(2)
 --------->AHL20(1)
<---------AHL12(3)
--------->AHL12(1)
<---------AHL12(1)
--------->AHL12(3)
--------->AHL25(1)
<---------AHL25(3)
--------->AHL25(3)
<---------AHL25(1)
---------AHL12(1)
-------->AHL12(1)
-------->AHL25(2)
-------->AHL25(3)
---------AHL25(2)
---------AHL20(1)
-------->AHL20(1)
---------AHL20(2)
---------AHL20(3)
-------->AHL20(3)
--------AHL12(2)
------->AHL12(2)                                                                         -----------
------AHL20(2)                                                                    <---------ARR11(2)
----->AHL20(1)                                                                    --------->ARR11(2)
----->AHL20(2)                                                      <---------ANAC58     --------->WRKY38(1)
----->AHL25(1)                                                      <---------ANAC46   --------->ANAC55(2)
----->AHL25(3)                                                      <---------ANAC58   <---------ANAC55(2)
------AHL25(1)                                            --------->ANAC58     ----------->GT1
------AHL20(3)                 --------->STY1(2)          --------->ANAC58   <---------ANAC46
----->AHL20(3)                 <---------STY1(2)          --------->ANAC46  --------->DAG2
------AHL25(3)        --------->DAG2                    --------->TOE1(2)  <---------ZAT14
------AHL12(3)       ---------->DOF2                 <---------GATA12      --------->ZAT14
----->AHL25(2)    --------->YAB1                     --------->RVE1(2)     ---------->DOF2<---------WRKY18(1)
------AHL25(2)   <---------ATHB12            --------->WOX13(2)<---------KAN1----------->GT1       <
 
aaaatatttttggcccactaatcaaaaagtttctagctactctagtctcattaacaaatccaaggaatttggggtgagtaaagtgtaaacacttgaccag  3029100
                             --------->YAB5
                             --------->AHL12(1)
                             <---------AHL25(3)
                             <---------AHL12(1)
                            --------->AHL20(2)
                            --------->AHL25(1)             <---------ZAT6
                            <---------AHL12(1)             ----------->GT1
                            <---------ATHB51          ------>MYB83
                            --------->AHL12(3)        ------>MYB46(1)
                            --------->AHL12(1)      <---------------AGL15
                            <---------AHL25(1)      --------------->AGL15
                            <---------AHL20(2)      <---------MYB59
                            --------->AHL25(3)     ----------------->AG
                          --------->AHL12(2)       <-----------------AGL2
                          --------->WOX13(2)       ----------------->AGL3
                        <---------AHL20(3)         =================================================
                        <---------AHL12(3)         ----------------->AGL2
                        --------->AHL20(3)         ----------------->AGL1                      -----
                        --------->AHL20(2)        -------->P <---------KAN1             --------->ANAC46
                        --------->AHL25(1)       <-----------GT1                        --------->ANAC58
 --------->YAB1         --------->AHL12(3)     --------->ANAC55(2)            --------->ARR11(3)
<---------YAB1          <---------AHL25(1)     <---------ANAC58 --------->RVE1(2)       --------->ANAC58
>HVH21                  <---------AHL20(2)     <---------ANAC55(2)           --------->GLK1(1) <----
---------WOX13(2)   <---------KAN1             <---------ANAC58--------->WOX13(1)    --------->ARR14(2)
 
tttattatagagtcacttagagagtatttaaataattcaaaacttggattacttaccaaatagagtaaatcaaatttcagagttcttgaattcgccacta  3029200
                  <----------DOF2
                  <---------DAG2
        --------->ANAC58
        --------->ANAC58
        <---------ANAC55(2)
        --------->ANAC55(1)                --------->YAB5
        --------->ANAC55(2)                ----------->GT1
        --------->ANAC46        <---------------AGL15
       <---------LBD16          --------------->AGL15                            --------->TOE1(3)
      --------->MYB52(1)        ====================================================================
    <---------MYB52(2)<---------YAB1      <---------YAB1        --------->At4g35610       <---------
================================================MADS_MADS       <---------At4g35610---------->DOF2
---->ARR11(3)    <---------ANAC58         ----------->GT1     --------->YAB1     --------->TOE2(3)
-----ARR11(3)    <---------ANAC58      <---------RVE1(2)     <---------YAB5<----------DOF2----------
 
tcttctaactcacggaagttgctttatttttgtttctacttagagatgataaaacaattttgtaatcagcaaactcttctttaacctaaagtacttatat  3029300
                                                         ------->GAMYB
                                                         <---------ALFIN1
                                                        --------->MYB46(3)
                                                   --------->WOX13(2)
                                                   <---------AHL12(2)
                                                   <---------WOX13(2)
                                                   --------->AHL12(2)
                                                  <---------AHL25(3)
                                                  <---------ICU4
                                                  --------->YAB5
                                                 --------->AHL20(2)
                                                 <---------AHL12(1)
                                                 --------->AHL12(1)
                                                 --------->AHL25(2)
                                                 <---------AHL25(1)
                                                 --------->AHL25(1)
                                                 <---------AHL20(2)
                                                 <---------AHL12(3)
                                                 <---------ATHB51
                                                 --------->ICU4
                                                 --------->AHL25(3)
                                                 --------->AHL12(3)
                                                --------->AHL20(3)
                                                <---------AHL12(2)                              ----
                                                <---------AHL20(3)                            ------
                                           ----------->GT1                                    ------
                                   --------->TOE2(3)  <-----------GT1                       <-------
         --------->YAB1           ----------->GT1<---------AHL25(3)                         --------
        <-------TEIL              <---------ZAT6--------->AHL12(2)                    --------------
======MADS_MADS                 ------>MYB46(1) --------->AHL25(2)           ----------->GT1<-------
------AGL15                     ------>MYB83    <---------AHL25(2)        --------->MYB52(2)<-------
----->AGL15                   <---------MYB59   --------->AHL25(3)<---------DAG2      <-------------
 
cagaaaccacattcatgagaaaccatacttaaacctaatgttaaacgagaaaataattaaccaccttcaatttttgttagtggataaatagagtaccaaa  3029400
                                                                  <---------ARR11(2)
                                                                  --------->RVE1(2)
                                                                  --------->ARR11(2)
                                                                  <---------ARR11(1)
                                                                  --------->ARR14(2)
                                                                  <---------ARR14(2)
                                                                 <---------CCA1(2)
                                                       <---------AHL12(2)
                             --------->ARR11(3)       <---------AHL25(3)
                             <---------ARR11(3)       --------->AHL12(1)
                             --------->RVE1(2)        <---------AHL12(1)
                             --------->GLK1(2)        --------->AHL20(2)
                          --------->AHL12(3)          <---------AHL12(3)
                          <---------AHL12(3)          <---------AHL25(1)
                          <---------AHL20(3)          --------->AHL25(1)
                          <---------AHL25(1)          <---------AHL20(2)
                          <---------AHL12(2)          --------->AHL12(3)
                          --------->AHL20(3)         <---------AHL20(1)
                         --------->YAB1              --------->AHL20(1)
                         <---------AHL25(3)          <---------AHL12(1)
                        --------->AHL20(2)           --------->AHL12(1)
                      <---------AHL12(2)             --------->AHL20(2)
                    <---------AHL20(2)               <---------AHL25(2)
                    --------->AHL20(2)               <---------AHL20(2)
                    <---------AHL12(1)               --------->AHL25(2)
                    --------->AHL20(3)               --------->AHL25(3)
                    --------->AHL12(1)               <---------AHL25(1)
                    --------->AHL12(3)               --------->AHL25(1)
      --------->ZAT18<---------AHL25(3)              --------->AHL12(3)
      <---------ZAT18--------->AHL20(2)              --------->AHL20(3)
----->YAB1          --------->AHL25(1)               <---------AHL20(3)
>MYB83<----------ID1<---------AHL20(3)               <---------AHL25(3)
>MYB46(1)           <---------AHL25(1)              <---------AHL12(2)                     ---------
--MYB111(1)         --------->AHL25(3)              --------->AHL12(2)                 <----------DOF2
->MYB46(3)          <---------AHL12(3)             --------->WOX13(2)                  <---------MYB52(1)
->AtSPL8          <---------WOX13(2)               <---------WOX13(2)     <---------YAB1  <---------
--MYB59           --------->WOX13(2)           ----------->GT1  --------->LBD16       <---------DOF5.7(1)
--MYB46(2)      <---------AHL20(2)      --------->ANAC58      <---------LBD16      ---------->ID1
--AtSPL8        --------->AHL20(2)      --------->ANAC58    <-----------GT1 <---------RVE1(2)    <--
 
caaaataagtggacaaattttaaataaataaaaatctatggacactcaagttgtaatttattttctccgtatccattttgattttagtccctttgttccc  3029500
                                                                                          <------ZmHOX2a(2)
                                                                                          <---------GLK1(1)
                                                                                          --------->GLK1(1)
                                                                                         <---------ARR11(3)
                                                                            <---------ZAT18
                                                                         <---------ANAC46<----------
                                                                 <------ZmHOX2a(2)       --------->GATA12
                                                           <---------SPL7(1)<---------ZAT14
                                                           <---------RAP2.6(3)           <---------AGP1
                                                           <-----------HVH21--------->ZAT14------>ZmHOX2a(2)
                                                         --------------->AtSPL3          --------->ARR14(3)
                                                    --------->TOE2(3) <---------ALFIN1   --------->RVE1(2)
                                                  --------->GLK1(2)   ------->GAMYB      <---------ARR14(2)
                                                  <-----------ARR10   --------->AtMYB61  --------->ARR11(3)
                                                  <---------GATA12   --------->MYB46(3)  --------->ARR14(2)
                                                  --------->RVE1(2)--------->WOX13(1)    <---------ARR14(3)
                <----------DOF2              --------->LBD16    --------->GATA12   <---------HSFB2a(2)
               *TSS                        <---------LBD16--------->DEAR3(1)--------->REM1(2)
->ID1 ------>ZmHOX2a(1)          --------->ATHB12 <---------ARR11(3) <---------MYB55(2)  <---------GATA12
---------------ANAC81           ------>ZmHOX2a(1) --------->ARR11(3)-------->P     --------->LBD16
-------CCA1(2) <---------DOF5.7(1)        --------->MYB52(1) --------->SPL7(1)     --------->HSFB2a(2)
 
atttctctcctctctctctctttctcgctctcttcctgatttgatcaccggaaaatcttagccgtccgatcaaccaccgtgtactccgagaagatctctt  3029600
                                        ------>NtERF2
                                       --------->ANAC46
                                    ------>ZmHOX2a(2)
                                   <------ZmHOX2a(2)
                                   <---------GLK1(1)
                                  --------->AGP1
                                  <---------AGP1                                           ---------
                                  --------->ARR14(3)                                       ------>NtERF2
                                  --------->ARR11(3)                                      --------->ANAC58
                                  <---------ARR14(2)                                      --------->ANAC46
                                  --------->ARR14(2)                                      --------->ANAC58
                                  --------->GATA12                                       <---------LBD16
                                  <---------GATA12                                     --------->ARR11(2)
                                  --------->ARR11(2)                                   --------->ARR14(2)
                                  <---------ARR11(2)                                   <---------ARR14(2)
                                  --------->RVE1(2)                                    --------->RVE1(2)
                                  <---------ARR11(3)               <---------DOF5.7(1)--------->KAN1
                            --------->ZAT2                        <---------DAG2    --------->TOE1(3)
                            <---------ZAT2   --------->KAN1       <---------DOF5.7(1)------>ZmHOX2a(1)
                            --------->At4g35610               ---------->ID1     <---------ARR14(2)
                            <---------At4g35610        <---------YAB1            --------->RVE1(2)
                       <-----------GT1 <---------ETT(1)<---------YAB5       ------>ZmHOX2a(1)
                  <---------RVE1(2)--------->GLK1(1)<---------MYB52(1)  <-----------GT1<---------ARR11(2)
                <---------YAB1  ----------->ARR10<---------LBD16 <---------DOF5.7(1)--------->TOE2(3)
-ARR10        <---------At4g35610<---------CCA1(2) --------->LBD16<----------DOF2--------->ARR14(2)
 
cgattacttcaacgttcttctgattttcaccagctcagatctccgacaacattccggtatcatttctcgcttttttttcctccaaatccttatccgccag  3029700
                                                                        --------->ARR14(2)
                                                                  ------->TEIL
                                                                  <---------GATA12
                                                                  --------->GATA12
                     --------->LBD16                        --------->GATA12
                 <---------GATA12                           --------->ARR14(2)
                 --------->GATA12                           <---------ARR14(2)
                 <---------ARR11(2)                        <------ZmHOX2a(1)
          <------ZmHOX2a(1)       <---------ZAT6         <---------TOE2(3)                         <
<---------ANAC55(2)------>ZmHOX2a(2)                     <---------TOE2(2)            <---------YAB1
<---------YAB1   --------->ARR11(2) ---------->DOF2      <---------TOE1(2)        <----------DOF2  <
>LBD16    ================HOX2a_HOX2a      --------->RVE1(2)<---------GATA12      <---------DAG2  --
 
attacgaaaatgaggagcttgatccgagagaggcatagtgaaagcttatctgtgaattcttaggatttgaatctgaatactcaggctttttgattccttc  3029800
                                                                                                  --
                                                       --------->ARR11(2)                     <-----
                                        <---------GATA12                                      <-----
                                   <---------ZAT6<---------At4g35610                          <-----
        <---------YAB1             ----------->GT1     <---------ARR11(2)                     <-----
   --------->KAN1             <---------ZAT2     --------->At4g35610                          <-----
<---------MYB52(1)         ----------->RAV1(2)   --------->ZAT2                               ------
-----------HVH21      --------->ZAT2    --------->GATA12                                   <--------
-------GAMYB          --------->At4g35610        <---------ZAT2                 <----------DOF2   --
------->ANAC46        <---------At4g35610     ------>ZmHOX2a(1)                 ------>ZmHOX2a(1)---
 
tccgttacatgctgattcaattttgagctcccctgctagtgtaaatctcctcagctcggaaacttagggtttagtttggggtcctttgctcttcgttgcg  3029900
    --------->YAB5
   --------->ICU4                                            ------->TEIL
------->ANAC58           --------->ALFIN1                   <-----------GT1
----ANAC55(2)         --------->DOF5.7(1)                 <---------ATHB12
----ANAC55(1)         --------->DAG2          --------->RVE1(2)
----ANAC46          ---------->DOF2           --------->ARR14(2)
----ANAC58        <---------YAB1              <---------GATA12                       -------->P
----ANAC58      <---------ICU4                <---------ARR14(2)                   --------->ETT(2)
--->ANAC55(2)   --------->YAB1      --------->ANAC58     <---------WOX13(2)     <------MYB83       =
-MYB52(1)<---------TOE2(3)          --------->ANAC58     --------->WOX13(2)    <---------AtMYB61   <
------->ANAC58  --------->YAB5 <------NtERF2  --------->GATA12--------->DEAR3(2)<------MYB46(1)  <--
------>SPL7(1)--------->ARR11(3)  ---------->DOF2 --------->LBD16 <-----------------AGL2   <--------
 
taagccatgtttaagaaaatcatgaaaggtgggcatcgaaagccctctaaatccgaagctaatgaaccgtctagttatgggattggtctacctgataata  3030000
<- Previous    Next ->

AGI:  At3g09880.1   
Description:  ATB' BETA (Arabidopsis thaliana serine/threonine protein phosphatase 2A 55 kDa regulatory subunit B prime beta); protein phosphatase type 2A regulator. Identical to Serine/threonine protein phosphatase 2A 57 kDa regulatory subunit B' beta isoform (B'BETA) [Arabidopsis Thaliana] (GB:O04376); similar to ATB' ALPHA (PP2A, B' subunit, alpha isoform), protein phosphatase type 2A regulator [Arabidopsis thaliana] (TAIR:AT5G03470.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN81062.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO68892.1); similar to predicted protein [Physcomitrella patens subsp. patens] (GB:EDQ67290.1);
Range:  from: 3029516    to: 3032261    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version