AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                     --------->ZAT14
                                     <---------ZAT14
                                    ------>ZmHOX2a(1)
                                  --------->At4g35610
                                 ------>NtERF2
                    <---------bZIP60(2)
                 ----------->TGA1<---------ATERF1(1)     --------->YAB1                       <-----
                 ----------->HVH21----------->RAV1(2)   <---------ATHB12                    <-------
         --------->YAB5    --------->MYB52(1)          ------>MYB46(1)                   <------NtERF2
----->DOF5.7(1)<---------ICU4   <---------ARR14(2)     ------>MYB83         --------->MYB52(1)<-----
---->DOF2--------->YAB1    <---------DOF5.7(2)        --------->WOX13(1)--------->ANAC58<---------DEAR3(2)
->ANAC58--------->ICU4    <---------WRKY12         ------>NtERF2        --------->ANAC58------>NtERF2
->ANAC58<---------ATHB12 --------->DOF5.7(2)  --------->DEAR3(2)    --------->CCA1(2)  <---------DEAR3(1)
 
agagtcttccaatgatcaacatgacgaggttaacggctcctgcagtgagaccgacaccaatcaagaagaagatagaagcaaactgcatcgtcggcctgcg  1784900
                         --------->ANAC58
                      ----------->HVH21
                    --------->ANAC46
                    --------->ANAC58
                    --------->ANAC58
                   --------->SPL7(1)                    <----------ID1
                  --------->ATERF1(1)           --------->MYB59
                  <------NtERF2              <---------At4g35610
                  ------>NtERF2              --------->ZAT2
                 <---------SPL7(1)           <---------ZAT2
                 ----------->HVH21           --------->At4g35610
                <---------ANAC58          --------->ZAT18
                <---------ANAC58          --------->ZAT14
                <---------ANAC46          <---------ZAT14                               --------->YAB1
                <---------RAP2.6(2)       <---------ZAT18                              -------------
               <------NtERF2         <---------TGA1a  --------->DOF5.7(1)              <---------YAB5
               --------->ATERF1(1)   ==========================bZIP_DOF       --------->ARR14(2)
         <-----------RAV1(2)         --------->O2<------MYB46(1)              <---------ARR14(2)
----ANAC58   --------->ALFIN1        <---------O2<------MYB83               --------->ANAC58
--ATERF1(1)  <---------DEAR3(1)      --------->TGA1a---------->DOF2   --------->At4g35610   <-------
----ANAC58 --------->ZAT2--------->ANAC58--------->ALFIN1--------->CCA1(2)  --------->ANAC58<-------
 
tccaagtttagaacaggtggcggacgcgacgaaactggccacgagtgcagctaggtaaagagacgaggtgaacagttgcaagaactggttatcgtacttg  1785000
                                                                                                   <
                                                                                             <------
                                                                                          <---------WOX13(2)
                                                                                        --------->AHL25(3)
                                                                                     <----------DOF2
               <---------ANAC58                                                     <---------DOF5.7(1)
               <---------ANAC58                                        <---------ZAT18  --------->AHL20(2)
   --------->KAN1                         ----------->GT1              --------->ZAT14  <---------AHL20(2)
  <---------YAB5                     --------->DEAR3(1)     --------->GLK1(1)       <---------DAG2--
<---------MYB46(3)                <---------ALFIN1          <---------GLK1(1)    <---------ALFIN1 --
-->AtSPL3      --------->ANAC55(2)--------->ANAC46        <------ZmHOX2a(1)   --------->ANAC46    <-
--ANAC58      ------->TEIL      <---------ALFIN1         --------->LBD16    --------->KAN1--------->WOX13(2)
--ANAC58 <---------ANAC46  ------>ZmHOX2a(1)   --------->KAN1          <---------ZAT14 --------->AHL20(2)
 
cagtagttgttctcgtgtacgtgcttcttcctctcccacaccgctgggaaaaattccttcaggaaatcgtccattgcacttactccaccttttaatttac  1785100
                                                                                       <------MYB46(1)
       --------->TOE2(3)                                                              <-------------
 ----------->GT1        --------->AtMYB61                                             --------->MYB59
------ZmHOX2a(2)       ----------------->AG                                         >>>>>>>>>CBP60g
-----GT1   --------->At4g35610              <-------TEIL <---------DOF5.7(1)        >>>>>>>>>SARD1--
------->GATA12   --------->ANAC58          --------->CCA1(2)            --------->ANAC58        ----
------->RVE1(2)  --------->ANAC58  <---------WOX13(2)   <---------DAG2  ----------->GT1<------MYB83
--------GATA12 ---------->DOF2  <---------MYB52(1)      <----------DOF2 --------->ANAC58  <---------ZAT14
 
agatcagtaacattagctaaaagcaaaccaaaacagttaacttgagatacaagttaagactttttcttgaaatgcaagtaaaatgaaatttggtacagag  1785200
                                                          --------->YAB5
                                                  --------->At4g35610
                                                  <---------At4g35610
                                              <-----------HVH21
                                              ----------->RAV1(1)
                                              ------>NtERF2
                                              <---------ATERF1(1)
                                              ===============================RAV
                                             --------->DEAR4(1)
                                             --------->DREB2C(2)
                                             ----------->HVH21
                                             <---------ETT(1)
                                            --------->ORA47(2)
                                            --------->ERF1--------->YAB1
               --------->GLK1(2)          ------->GAMYB   <---------ICU4
             <----------TaMYB80           --------->DEAR3(1)
             --------->GLK1(1)           --------->MYB46(3)
             --------->HSFB2a(1)    <------ZmHOX2a(2)    --------->ICU4
             --------->KAN1        <---------ARR11(3)    <---------ATHB12
             <---------GLK1(1)     --------->RVE1(2)     <---------YAB5
            --------->ARR14(2)     --------->ARR11(3)  --------->WOX13(1)
            <---------ARR14(2)     <-----------ARR10 <------NtERF2
          --------->LBD16          <---------GATA12 --------->RAP2.6(2)
       --------->MYB52(1)  --------->ARR11(2)--------->DEAR3(1)
      <---------ARR11(2)   <---------ARR11(2)--------->RAP2.3(3)
      --------->ARR11(2)   <---------ARR14(2)--------->At1g77200
      <---------ARR14(2)   --------->ARR14(2)--------->ATERF1(2)      --------->YAB5
      --------->MYB52(1)   --------->MYB52(1)<---------ATERF1(2)   --------->At4g35610
--AtSPL8<---------LBD16 <---------ANAC58 <---------MYB55(2)        <---------At4g35610           ---
------->DOF5.7(1)       <---------ANAC58 --------->DEAR3(2)  ---------->DOF2                   <----
------>DOF2 --------->ARR11(2)------->GAMYB --------->RAP2.3(1)  <-----------RAV1(2)    <---------ICU4
 
aaagagaagtaaccggaaattccgatgtcgtaaccgaagatcaaaccgccgacagcggcaatcataacgcagatgaatacatagacagtcatcttggcct  1785300
                                              --------->GATA12
                                            <---------AHL20(2)
                                           <---------AHL25(3)
                                           <---------AHL20(2)
                                           --------->AHL20(2)
                                           <---------AHL20(3)
                                           <---------AHL25(1)
                                           --------->AHL25(3)
                                           --------->AHL25(1)
                                           --------->AHL20(3)          <---------WOX13(2)
                                         <---------WOX13(2)            --------->WOX13(2)
                                         --------->WOX13(2)       --------->ANAC46               <--
                                       --------->AHL25(1)         --------->AtLEC2               <--
                                       <---------AHL20(2)         --------->ANAC58               ---
                                       <---------AHL25(1)    <---------ALFIN1                   ----
     <------NtERF2                  --------->YAB5          --------->MYB46(3)                  ----
    --------->LBD16                --------->ICU4    --------->At4g35610             <---------AHL12(3)
    <------NtERF2             ------->GAMYB--------->AHL12(3)--------->AtMYB61       ----------->TBP
   <---------DEAR3(1)        --------->MYB46(3)      <---------At4g35610 --------->AHL20(2)     ----
  <---------LBD16          ----------->RAV1(1)<---------GATA12    --------->ANAC58   <---------AHL20(2)
------->DOF2              --------->MYB46(3)<---------AHL25(3)  <---------ALFIN1   <-----------TBP--
--NtERF2             --------->ANAC46  --------->AHL20(2) --------->ANAC46<-----------GT1 <---------
 
caaaggccggagcattggcattagacacaacaacagccatgtttaattaaatctcgagcagacaccaccacgcaaattaactcagtatatatatgtcaaa  1785400
-------AHL25(3)
-------AHL20(1)
------>AHL20(1)                     --------->DOF5.7(1)      <------ZmHOX2a(1)
----->AHL12(3)                    ---------->DOF2     --------->At4g35610          ----------->HVH21
----->AHL20(2)                 <---------At4g35610    <---------ZAT2        <---------ANAC46
----->AHL25(1)                 --------->At4g35610    <---------At4g35610  <---------ZAT2
------->CCA1(2)               --------->ANAC58        --------->ZAT2       --------->ZAT2          <
--HVH21                       --------->ANAC58   <---------TOE2(3)   --------->GLK1(1)       <------
 
tatataagtgtttgtatatgtgtgtgtctgtgtaagctaaagatgaaacatgaaggaagctgaaggagacagagaccctgcttgaaatgacagaccctgt  1785500
                            <---------YAB1
                          <---------AHL20(2)
                       ------->TEIL
                    --------->ANAC55(1)
                    --------->ANAC55(2)
                    --------->ANAC58
                    <---------ANAC55(2)                                  --------->GLK1(2)
                    --------->ANAC58                                    --------->GATA12
                 <------ZmHOX2a(2)                                      <---------GATA12
                <---------ARR11(3)                             --------->MYB52(1)
                <---------GATA12                             <---------MYB59
               --------->GLK1(1)                         ----------->HVH21           ---------------
        <---------REM1(1) --------->YAB1               <---------ANAC55(2)           <--------------
     --------->DOF5.7(1)<-----------TBP            --------->RVE1(2)  <---------RVE1(2)        <----
 --------->YAB1<---------GLK1(1)             <-----------HVH21 ------>MYB83         <---------------
---------RVE1(2)--------->ARR11(3)          --------->bZIP60(2)------>MYB46(1)      <---------------
-----RAV1(1) <------ZmHOX2a(1)       ---------->DOF2   --------->ANAC55(2)<-------TEIL  --------->DOF5.7(1)
 
tggataataagatgaaggagatcacgtatttataagtgataaaagacatgtcagaatcacatgaccaaactgtgagattcagacttgtctaaaaatggga  1785600
                                                                                                  <-
                           --------->ANAC46                           <----------DOF2             <-
                          <---------LBD16                          --------->ARR11(3)            <--
                        <-------TEIL                               <---------ARR11(1)            ---
                       --------->CCA1(2)                           --------->GATA12              ---
                      --------->ARR14(2)                      ------>ZmHOX2a(2)                  <--
                      --------->ARR11(2)                    --------->ARR11(3)                   <--
                      <---------ARR11(3)                    <---------GATA12                     ---
>AGL15                <---------ARR14(2)                    <---------ARR11(3)                   <--
-AGL15              ----------->ARR10                       <---------AGP1---------->ID1       <----
--------CBF         --------->ANAC58                        --------->GATA12      <----------DOF2---
--AGL2              --------->ANAC58            <---------RVE1(2) <---------CCA1(2)     <----------DOF2
--AGL3        --------->At4g35610    <---------AtLEC2      <---------CCA1(2)<----------DOF2  ------>ZmHOX2a(1)
 
ttgtttttcgaaatagcatcggcaagatacacggggttttgtatggtctgtgatttgtttttggatctcaaatctttttctttttctttcactttcctat  1785700
     --------->ARR11(2)                       ----------->RAV1(2)
   <---------MYB46(3)                        <---------GATA12
--------AHL12(2)                             --------->GATA12
--------YAB1                              <---------ALFIN1
-------AHL25(2)                          ------>MYB46(1)
------>AHL12(3)                          ------>MYB83                         --------->MYB52(1)
------>AHL20(3)                         ==================RAV                 ------>MYB83
-------AHL20(3)     <----------DOF2     ----------->RAV1(1)                   ------>MYB46(1)
-------AHL20(1)  --------->ARR11(3)    --------->AtMYB61                    <---------MYB59
------>AHL25(2)  --------->GATA12      --------->MYB46(3)                   --------->AtMYB61
-------AHL20(2)  <---------ARR11(1)   --------->MYB46(3)        <-----------GT1                 ----
-----YAB1   <-----------HVH21 --------------->AtSPL8         <---------WOX13(2)           ------->GAMYB
------>AHL12(2) <---------CCA1(2)    --------->ANAC46        --------->WOX13(2)          --------->MYB46(3)
 
tatttttggttacacagtcaaatctttctgtaccaagtaccaccaacacatctggctcaagggtatttaacctggttaaccaaaccgattcaaccaaaaa  1785800
<- Previous    Next ->

AGI:  At3g05960.1   
Description:  sugar transporter, putative. Identical to Sugar transport protein 6 (STP6) [Arabidopsis Thaliana] (GB:Q9SFG0;GB:O81704); similar to sugar transporter, putative [Arabidopsis thaliana] (TAIR:AT5G26250.1); similar to monosaccharide transporter [Populus tremula x Populus tremuloides] (GB:CAG27608.1); contains InterPro domain General substrate transporter; (InterPro:IPR005828); contains InterPro domain Major facilitator superfamily; (InterPro:IPR007114); contains InterPro domain Sugar transporter, conserved site; (InterPro:IPR005829); contains InterPro domain MFS general substrate transporter (InterPro:IPR016196); contains InterPro domain Sugar t
Range:  from: 1783593    to: 1785340    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version