AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                   --------->TOE2(3)
                                   --------->TOE1(3)
                                  <---------KAN1
                                 --------->SPL7(1)
                          <---------At4g35610
                          <---------ZAT2
                      --------->TOE1(1)                                                      -------
                      --------->TOE2(1)              --------->MYB46(3)                      <------
           --------->At4g35610   ------->TEIL      ------>MYB83                      --------->ZAT18
        --------->LBD16 <---------CCA1(2)          --------->ANAC46                  ------>NtERF2
      ----------->RAV1(2) --------->At4g35610      ------>MYB46(1)               --------->ALFIN1  <
------RVE1(2)        ------>ZmHOX2a(1)           <---------MYB59              <---------RVE1(2)  ---
---DOF2 ------>ZmHOX2a(1) --------->ZAT2         --------->AtMYB61 <---------ALFIN1  <---------ZAT18
 
atgttctcatcctgagcacaagtcctcgtagctccgaacgttagagagtagaccaaaccactcttcaccctcacgttctgagagatggtgcccaagtttc  17444700
                    ------->MYC3
                    <-------MYC3
                    ------->MYC2
                    <-------MYC2
                    <-------PIF5                                                  <------NtERF2
                    ------->PIF5                                                 --------->LBD16
                    ------->MYC4                                                <---------DEAR3(1)
                    <-------MYC4                                               <---------LBD16
                   <---------O2                                             ----------->HVH21
                   --------->O2                                            <-------MYC2
                   ========================================MYC_MYB         ------->MYC3
                   --------->PIF3(3)                                       <-------PIF5
                   --------->TGA1a                                         ------->MYC2
           --------->ZAT18                                                 ------->PIF4
         ------->MYC3                                                      ------->PIF5
         <-------MYC3       ----------->GT1                                <-------MYC4           <-
        <---------ANAC46<---------ARR14(2)             <-------TEIL        <-------MYC3         <---
      ------->GAMYB<---------TGA1a                     --------->ETT(2)   --------->TGA1a <---------
      =======================MYC_MYB                   <---------WRKY12   --------->O2<---------GLK1(1)
    <---------At5g28300 <---------ARR11(2)         <---------AtMYB61      --------->ANAC46----------
   --------->MYB52(1)   --------->ARR11(2)      ====================================MYC_MYB    -----
   --------->ARR11(2)  <---------SPL7(1)        <----------CDC5           <---------TGA1a<----------
   <---------ARR11(2)--------->ALFIN1       <-----------RAV1(2)         <------------OsbHLH66 <-----
-->ARR11(2)<---------ZAT18 ----------->GT1------>ZmHOX2a(1) --------->LBD16<-------PIF4  -----------
---ARR11(2)--------->WRKY38(1)        <---------ARR14(2)  <---------LBD16 <---------O2--------->GLK1(1)
-----------ARR10   <---------PIF3(3)  --------->ARR14(2) --------->MYB52(1)------->MYC4  <----------
------>LBD16     <---------ALFIN1     --------->ARR11(2)<---------ALFIN1<---------ALFIN1 -----------
 
cgagtctaaccgcgtggactccacgtggaacggggaaatagaatcctccaggctgaggtccaccggagactagctccacgtgcccggcgatttcccaatg  17444800
    <---------ZAT6                                                            <---------ARR14(2)
-----ZmHOX2a(1)                                                               --------->ARR14(2)
------TOE2(3)                                                     ----------------->AGL1
------AGL15                                                     <-----------GT1          --------->CCA1(2)
----->AGL15                                                   --------->HSFC1(2)        --------->ARR11(1)
---->YAB1               <---------ETT(2)                      <---------HSFB2a(1)       --------->ARR11(3)
-------AG               --------->ETT(2)                      --------->HSFB2a(1)       <---------RVE1(2)
----ATHB12       --------->AHL12(1)                           <---------HSFC1(2)        <---------ARR14(2)
------>AGL1      --------->AHL20(2)     <---------RVE1(2)<---------HSFB2a(2)  --------->GLK1(2)
-------AGL1      <---------KAN1   <---------YAB1     <---------KAN1           <---------ARR11(2)
------>AG        <---------AHL12(1)    --------->ATHB12  --------->HSFB2a(2)  --------->RVE1(2)
 
aggaagagagttagccccgattatttgtcgacccttcatgtttgatttgagaggggttatctcgaagtttccatttgggagaatccctatagatatggaa  17444900
                                      --------->AHL20(1)
                                      <---------AHL20(2)
                                      --------->AHL25(2)
                                      --------->AHL20(2)
                                      <---------AHL12(3)
                                      --------->AHL25(1)
                                      <---------AHL25(1)
                                      <---------AHL25(3)
                                      <---------AHL25(2)
                                      <---------AHL12(1)
                                      --------->AHL12(1)
                                      --------->AHL25(3)
                                     <---------AHL25(2)
                                     --------->AHL25(1)
                       --------->WOX13(2)            --------->ICU4
                     --------->AHL20(2)     <---------RVE1(2)              <---------ANAC58
             <-----------HVH21       --------->AHL12(3)        <-----------GT1
             <-----------TGA1        --------->AHL20(2)     --------->YAB1 <---------RVE1(2)
            --------->ANAC46         --------->AHL25(2)   --------->AHL25(2)             --------->HSFB2a(2)
            --------->bZIP60(2)      --------->AHL25(3)   <---------AHL25(2)       <---------At5g28300
       <-----------GT1 <---------WOX13(2)<---------WOX13(1)<---------YAB1  <---------ANAC58
    <---------KAN1   <---------AHL20(2) --------->WOX13(2)--------->AHL20(2)      <-----------GT1
    <---------ICU4   <---------AHL25(1) <---------WOX13(2)--------->AHL20(3)     <---------SPL7(1)
   ------->TEIL      --------->AHL25(1)<---------AHL25(3) <---------AHL20(3)<---------WOX13(1)    <-
 --------->YAB5  <---------YAB1     --------->WOX13(2)  ------->TEIL      --------->ATHB12       <--
<---------YAB1   --------->ICU4     <---------WOX13(2)--------->YAB5     <---------YAB1  <---------HSFB2a(2)
 
accatgaatattacaacgtcatgtttaattagtttatcaaattaattgatatagaaatgaatattataacttcatgttgattgtcttaccgtctagatga  17445000
         <-------GAMYB                                                                          <---
        <---------MYB46(3)                                                                    ------
       --------->ALFIN1                                                                       <-----
     <---------O2                                                                            <------
     ============MYC_MYB                            --------->KAN1                          --------
     <---------bZIP60(2)                         <------ZmHOX2a(1)                          <-------
     <---------TGA1a                          <------ZmHOX2a(1)                             <-------
     --------->O2                          <------ZmHOX2a(1)                                <-------
     --------->TGA1a                    --------->CCA1(2)                                   --------
     <---------ANAC46                  <---------RVE1(2)                                    --------
--------ARR14(2)                      --------->CCA1(2)                                     --------
----ZmHOX2a(1)                    <------NtERF2----------->GT1   <---------ZAT6   ---------->DOF2
 
ggaactcgacgtggttgaagactgtaagagccatggcagagagataggaggaggaaaatgctaagagagtgatagagagacattttaaagtcttattaat  17445100
                                                                                <---------YAB1
                                                                                ----------->TBP
        --------->RVE1(2)                                                     --------->YAB1
------ICU4                                                                 <---------RVE1(1)
--->WOX13(2)                   <-----------TBP                             <---------CCA1(1)
----WOX13(2)                <-----------------AGL3                         --------->KAN1
---AHL20(2)              <---------ZAT18                                  <---------RVE1(2)
->AHL25(3)        --------->ARR11(3)           <-----------GT1            <---------ARR11(3)
--AHL12(1)       *TSS    --------->ZAT18----------->GT1                   --------->ARR11(3)
--AHL25(1)       <------ZmHOX2a(1)    <------ZmHOX2a(1)          ----------->HVH21
--AHL20(2)    --------->YAB1----------------->AGL3             <---------ANAC55(2)                <-
->AHL20(2)    --------->YAB5========================================================================
->AHL12(1)   <---------ATHB12<---------------AGL15             --------->ANAC55(2)            ------
->AHL25(1) --------->WOX13(1)--------------->AGL15           <-----------GT1 <---------YAB1 --------
 
tagttcgcctatatcaatgaggaccttgtgggctatatataggaggttttatacttatcagttatcacttgacatgagatattataaataagaaacaaag  17445200
                                                          <---------AHL12(1)
                                                          <---------AHL25(2)
                                                          <---------AHL25(3)
                                                          --------->AHL25(2)
                                                          <---------AHL25(1)
                                                          --------->AHL12(1)
             <-------TEIL                                 --------->AHL20(1)                    ----
             ------->TEIL                                 --------->AHL20(2)                 -------
             <-----------------AGL1                       <---------AHL20(2)                 -------
          <---------KAN1                                 --------->AHL20(2)                  <------
    <---------At4g35610                                  --------->AHL12(3)          --------->REM1(2)
    --------->At4g35610                                  --------->AHL25(2)        --------->LBD16
    --------->ZAT2                                       --------->AHL25(1)       <---------ANAC58
 <---------At4g35610                                     --------->AHL25(3)       <---------ANAC58
 --------->At4g35610                                <------NtERF2                 <---------ANAC46
-----ZmHOX2a(1)                                   --------->ETT(1)             <---------ARR11(2)
===============================MADS_MADS         --------->RAP2.6(3)      ---------->DOF2    <------
--->DOF5.7(1)<-----------------AG            --------->WOX13(2)     <---------YAB1<---------ANAC55(1)
-->DOF2  --------------->AtSPL8   ----------->RAV1(1)    <---------AHL25(2)    --------->ARR11(2)
 
aggaagcagcagcatgtacatttttggaaatatacaacaacaaaactaaattgtcggcaaaaaaattgtttatgagagaaagtttccgtgtagaagtata  17445300
                                        <---------RAP2.6(3)
                                       --------->ANAC58
                                       --------->ANAC58
                                       --------->RAP2.3(3)
                                       --------->RAP2.6(2)
                                       --------->RRTF1(3)
                           <---------ALFIN1
                         --------->RAP2.6(2)
                   ---------->DOF2     --------->RRTF1(2)
                 --------->DOF5.7(2)   --------->RAP2.3(2)
          --------->ARR11(2)------->TEIL--------->LBD16
    --------->KAN1 <---------DOF5.7(2)--------->RAP2.3(1)
 ----------->GT1--------->TOE2(3)   --------->ANAC46
----->ANAC46   --------->ANAC58   <---------ANAC58
-->ARR11(2)    --------->ANAC46   <---------ANAC58
-->ARR14(2)    --------->ANAC58<---------SPL7(1)                                                   <
---ARR14(2)  <---------ALFIN1 <---------DAG2                 <-----------HVH21              --------
---ARR11(2) --------->MYB46(3)<---------DOF5.7(1)--------->YAB5             <---------MYB52(1)   ---
 
cgaagggaaactcgaaccacgttaaagaccgcaccttacgagccgcaatgtatgactcactgtctgtcatgttacttcggttttgtattaaacgatggaa  17445400
                                     --------->ANAC55(2)
                                     <---------ANAC55(1)
                                     <---------ANAC58
                                     <---------ANAC55(2)
                              <---------AHL25(3)
                             --------->AHL20(2)
                             <---------AHL20(2)
                           <---------WOX13(2)
                          --------->YAB1
                          --------->YAB5
                          <--------HAHB4
                          --------->ATHB51                             --------->At4g35610
                         --------->AHL20(2)                            <---------At4g35610
            <----------DOF2<---------AHL12(2)                        --------->ZAT14
            <---------DAG2<---------ICU4  <---------ANAC58           <---------ZAT18
           --------->ANAC46--------->WOX13(2)                     <---------ANAC46
         <-----------GT1 --------->AHL25(3)                     --------->ZAT14
    <---------AHL12(2)   --------->AHL12(1)                     --------->ZAT18
    --------->WOX13(2)   <---------AHL12(1)                  <---------ANAC58                     --
    <---------WOX13(2)   --------->ICU4   <---------ANAC46   <---------ANAC46                    ---
-----------GT1           <---------KAN1   <---------ANAC58   <---------ANAC58           <---------AHL20(3)
--->GT1<-----------GT1 --------->YAB1<---------ANAC58    <----------DOF2  <-----------HVH21      <--
------>AHL12(2)    ---------->DOF2  <-------TEIL <----------DOF2<---------ZAT14  --------->At4g35610
 
aattactaatttacactttaccaaaagaataattaaaaatacgtgtcttgtgctttgtgactttgtgtgcagtgagctatcagacgctgaaaaatatgca  17445500
                                                                           <---------AHL20(2)
                                                                          <---------AHL25(3)
                                                                          <---------AHL20(3)
                                                                          <---------AHL25(1)
               <---------ARR14(2)                                         --------->AHL25(2)
               --------->ARR11(2)                                         <---------AHL12(2)
               --------->ARR14(2)                                         <---------AHL25(2)
        --------->ANAC46                                                  --------->AHL20(3)
        --------->ANAC58                                                  --------->AHL20(2)
        --------->ANAC58 ------->MYC3                                     --------->AHL20(1)
    ------>MYB83 --------->YAB1                                           <---------AHL20(1)
    ------>MYB46(1)      ------->MYC4                                  <---------AHL12(3)
 <---------HSFC1(2)      <-------MYC3                                  --------->AHL20(3)
 --------->HSFC1(2)------>ZmHOX2a(1)                                   <---------AHL20(3) --------->WOX13(2)
 <---------KAN1--------->GLK1(2) <---------ANAC46               <---------ANAC46        <---------AHL20(2)
 --------->HSFB2a(1)     ------->MYC2                         <---------ZAT2           --------->AHL20(2)
 <---------HSFB2a(1)     <-------MYC2                         --------->At4g35610  <---------ARR11(3)
------->TEIL--------->ANAC58     <---------ANAC58             <---------At4g35610--------->ANAC58
----->GAMYB --------->ANAC58<---------AtLEC2   --------->RVE1(2)----------->GT1  --------->ANAC58
------>MYB46(3)------->TEIL<-------TEIL     --------->YAB1    --------->ZAT2   <---------ICU4 ------
-------MYB52(2)<---------ARR11(2)<---------ANAC58          <---------At4g35610 --------->YAB1 ------
 
acgaaccttccaagcacgaatcctaacatgtgcatggtgtgattcaaacatatcacgagcgatgctgctgtgaaaaatataatcaagacattaaatgaac  17445600
<- Previous    Next ->

AGI:  At2g41800.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G41810.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO23583.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN80832.1); contains InterPro domain Protein of unknown function DUF642 (InterPro:IPR006946); contains InterPro domain Galactose-binding like (InterPro:IPR008979)
Range:  from: 17443607    to: 17445118    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version