AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                            <-------
                                                                                           <--------
                                                                           --------->AHL20(3)
          <---------AHL20(2)                                   --------->RVE1(2)         <---------AHL12(3)
          <-----------GT1                                    <---------AHL12(1)          --------->AHL25(1)
        --------->WOX13(2)                                   <---------AHL20(1)          <---------AHL20(3)
        <---------WOX13(2)                                   --------->AHL20(1)          --------->AHL20(3)
    --------->YAB1                                           --------->AHL12(1)     ----------->GT1
    --------->TOE2(3)           <---------ICU4               <---------AHL20(2)   ---------->DOF2
--------->KAN1                  --------->YAB5             --------->AHL12(2)   --------->YAB1 <----
----------GT1 --------->AtLEC2  <-----------GT1         --------->AHL20(2) <---------AHL20(3) ------
--GT1  <---------ICU4     <---------WOX13(2)          ----------->GT1----------->RAV1(1) --------->AHL20(2)
 
ttcacattcttaattacatgctaagtgctaactaataactatgtagtttgataaaacaagttaatatatcaacaacatttttatcaaaagaaaaaaataa  12623200
                                                    <---------AHL25(2)
                                                    <---------YAB1
                                                    <---------AHL20(3)
                                                    --------->AHL25(2)
                                                    <---------AHL12(2)
                                                    <---------AHL20(2)
                                                    --------->AHL20(1)
                                                   --------->AHL25(2)
                                                   --------->AHL25(1)
                                                   <---------AHL25(2)
                                                   <---------AHL12(3)
                                                   --------->YAB1
                                   ------>ZmHOX2a(1)--------->AHL20(3)
                              ------->GAMYB        <---------AHL25(1)
                           --------->MYB52(1)      --------->AHL20(2)
                           ------>MYB46(1)<---------WOX13(2)
                           ------>MYB83   --------->WOX13(2)
                          ----------->HVH21        --------->AHL12(3)
                          --------->MYB55(1)       <---------AHL25(3)
                         <---------MYB59 ------>MYB46(1)
                         <---------MYB55(2)      --------->AHL25(2)
                         <---------MYB111(2)     <---------AHL25(2)
                         <---------MYB46(2)      --------->AHL20(2)
                         <---------MYB52(2)      --------->AHL20(3)     <---------WOX13(1)
                         --------->MYB46(3)     --------->YAB1         <---------WOX13(2)
                         <---------MYB111(1)  --------->AHL20(2)       --------->WOX13(2)
                        --------->At4g35610  <---------AHL20(2)       --------->ATHB51
                        <---------ANAC55(2) --------->AHL20(2)       <---------YAB1
 --------->RVE1(2)      --------->ANAC55(2) <---------AHL20(2)  --------->YAB5       <---------YAB1
--AHL12(2)         <---------bZIP60(1)   ------>MYB83         ------->TEIL--------->ATHB12
-AHL12(2)          --------->bZIP60(1) <---------MYB59<---------ICU4 <---------AHL20(2)
-------GT1         --------->TGA2(1)   --------->TOE2(3)  <---------TOE2(3)        --------->YAB1 --
--->AHL20(2)     <-----------GT1  <---------MYB59<---------AHL20(3) --------->AHL12(2) ---------->DOF2
 
actatatcaacatggacaaattacatcacctaacggtcctaacctaatttaaaataatattgatgtatgtttataattgatttctataatgaaagaaaac  12623300
                                       <---------WOX13(2)
                                   --------->TOE2(3)
                            ---------->DOF2         ------>ZmHOX2a(1)
                          =================================HOX2a_HOX2a                          ----
                          <------ZmHOX2a(2)        --------->TOE2(3)                            ----
   <----------ID1        <---------ARR11(3)       --------->YAB5                                ----
   ----------->GT1       --------->RVE1(2)     --------->WOX13(1)                          ---------
<----------ID1           --------->ARR11(3)   --------->YAB5                             -----------
--------->DOF5.7(1)    --------->DOF5.7(1)   <---------YAB5                              --------->At4g35610
-------->DOF2        ---------->DOF2  --------->MYB52(2)                <---------YAB5   <---------At4g35610
 
aaaaagacgaaaaaaacaacatgctaaagatcaaagaacattagttgaatcaatccttattttgaacaaagaatagtcagtccattttgttcacctgaaa  12623400
                                                                                          <---------
                                                                                       <---------AHL25(1)
                                                                                       <---------AHL25(3)
         --------------->AGL15                                                         --------->AHL12(3)
         <----------DOF2                                                               --------->AHL20(2)
      ------>NtERF2                                                                    <---------AHL20(2)
     --------->DEAR3(1)                                                                --------->AHL25(1)
     <---------ALFIN1                                                                 --------->AHL25(3)
  --------->ANAC58                                                                   <---------AHL12(3)
  ------->GAMYB           <<<<<<<<<ARR2                                              --------->AHL12(3)
  --------->ANAC58        <<<<<<<<<ARR1          ---------->DOF2              --------->YAB5
  --------->ANAC46        <---------ATHB12     --------->AtMYB61            --------->GLK1(2)
----->ANAC46    ----------->GT1             --------->ANAC46                --------->ARR11(3)
----->ANAC58    --------->YAB1    <---------GATA12                          --------->RVE1(2)<------
----->ANAC58 <---------AtLEC2     --------->RVE1(2)                         <---------ARR11(3)
-->HVH21<---------DOF5.7(1)--------->YAB1   --------->ANAC58       --------->AtMYB61 --------->AHL12(2)
>RAV1(2)<---------DAG2    <---------YAB5    --------->ANAC58  --------->RVE1(2)<----------DOF2<-----
 
cgcaaacgccacctttgtatggtaatacaatcatacaaatctcatacacaccaaaagaaacacaaaatcaccaaaacaaaatctttatatttatttcttt  12623500
                              --------->KAN4(2)
                             <---------KAN4(1)
                             --------->KAN1--------->O2
                             <---------AHL12(1)
                             --------->AHL12(1)      --------->RAP2.6(2)
                           <---------GLK1(2)      --------->ANAC58
              <---------YAB1 --------->KAN4(1)    --------->ANAC46
             --------->WOX13(2)            --------->ANAC46                                       --
           ------>ZmHOX2a(1)<---------YAB1 --------->ANAC58                                       --
    <---------RVE1(2)     --------->YAB5   --------->ANAC58                               <---------HSFB2a(1)
    <---------GLK1(2)    --------->DOF5.7(1)<-----------HVH21                             <---------HSFC1(2)
--------->TOE2(3)<---------TOE2(3)         --------->TGA1a                            ----------->GT1
<---------ANAC58=====================================bZIP_DOF                       ---------->DOF2
<---------ANAC58---------->DOF2            --------->bZIP60(2)         <---------GLK1(2)  --------->HSFC1(2)
--GT1      --------------->AGL15          --------->MYB46(3)           --------->GATA12   --------->KAN1
----DOF2   <---------------AGL15   <<<<<<<<<TBF1  --------->ANAC58     <---------GATA12   --------->HSFB2a(1)
----DOF5.7(1)<---------WOX13(2)<---------YAB1----------->HVH21   <---------YAB1     --------->DOF5.7(1)
 
tttccttgattctccttattaaagaaaaaagattattcttcttcacccgtcacaagccacaacgacttattttagattcccatacaaaaaagaaaattcc  12623600
                                            <---------ANAC58
                                            <---------ANAC58
                                         <---------WOX13(1)
                                        <------------CBF
                                        --------->WOX13(2)
                                     ------>ZmHOX2a(1)
                                    --------->TOE1(3)
                                  <---------YAB1
                               <------ZmHOX2a(2)
                     <---------ICU4 --------->TOE2(3)                   --------->TOE2(3)
                     --------->ARR14(2) <---------WOX13(2)              --------->YAB1
                     <---------ARR14(2) *TSS<---------ANAC46            --------->TOE1(3)         --
         --------->ARR11(3)    =============HOX2a_HOX2a        --------->ARR11(3)          ---------
         <---------ARR11(3)   <---------ARR11(3)               <---------ARR11(3)          <--------
------->GATA12 =======================HOX2a_HOX2a              --------->RVE1(2)          <---------ARR11(3)
------->RVE1(2)------>ZmHOX2a(1)--------->KAN1                <---------CCA1(2)           --------->ARR11(3)
 
acatctataaaacatctcctcccatatttgctggatcatccttaattgcctgtgttcatgtcttcatatctctaaccataagataaaactcaagatttct  12623700
                      <-------TEIL
              <---------GLK1(1)
          --------->HSFB2a(2)                             <---------ANAC46
      --------->ZAT2--------->ARR14(2)               --------->MYB52(2)
      --------->At4g35610                       <---------TOE2(2)
      <---------ZAT2--------->ARR11(2)          <---------TOE1(2)
      <---------At4g35610                 <---------GLK1(2)
  <------ZmHOX2a(1) <---------ARR14(2)    <---------RVE1(2)
------->DOF5.7(1)   <---------ARR11(2)<---------At4g35610 <---------ANAC58                    ------
>GLK1(1)  <---------HSFB2a(2)         ----------->RAV1(2) <---------ANAC58                   <------
-GLK1(1) <---------LBD16    <-----------GT1    <-----------RAV1(2) ---------->DOF2 ----------->GT1
 
gaagaggacagctctggaattcatatacgttttgcctctccatctgattctcaggtttgtttcttgtcttaaaagaaacacaaaatgggtttatttgaat  12623800
                                                       ---------->DOF2
                                               ------>ZmHOX2a(2)
                                              <------ZmHOX2a(2)
                                              <<<<<<<<<GATA-1
                                              <<<<<<<<<GATA-2
                                              <<<<<<<<<GATA-3                                    ---
                             <------ZmHOX2a(2)<<<<<<<<<GATA-4                                    ---
                            --------->RVE1(2)--------->GATA12                                    ---
        --------->AHL20(3)  <---------GATA12 <---------AGP1                                      <--
        --------->AHL20(2) ==========================HOX2a_HOX2a                                 <--
    --------->YAB1         <------ZmHOX2a(1) --------->ARR11(3)               <---------At4g35610<--
    --------->YAB5     --------->DOF5.7(1)   <---------ARR11(3)               --------->At4g35610---
   <---------YAB5---------->DOF2             <---------GATA12             <-----------GT1        <--
   <---------ATHB12  ---------->DOF2        <---------CCA1(2)       <---------ANAC46             ---
->TEIL  <---------AHL20(3) ===========================HOX2a_HOX2a   <---------ANAC55(2)         <---
---CCA1(2)    <---------ANAC55(2)      <---------RVE1(2)            ----------->GT1--------->HSFB2a(2)
 
cttttaatcataaaaatacttaaagaaagaggatcaaatgttgatttagatctctaatgaaagtttgtgtaacgtataaacagcttatggaattggagca  12623900
                                                                                                 ---
                                                                            --------->ARR11(2)------
                                                                            --------->ARR14(2)<-----
                                                                            <---------ARR11(2)------
                                                                            <---------ARR14(2)<-----
------>ARR14(2)                                                          --------->ALFIN1    -------
------>RVE1(2)                                                           <------NtERF2    --------->LBD16
------>GATA12                                                          <---------ANAC46   <<<<<<<<<<AtSR1
-------GATA12                                                          <---------ANAC58  <---------ANAC46
-------ARR11(2)                                                        <---------ANAC58  <---------ANAC58
---------ARR10          <------ZmHOX2a(1)                       <---------WOX13(2)       <---------ANAC58
------>ARR11(2)   --------->YAB5                               --------->AHL12(1)    <---------ANAC58
-------ARR14(2)   --------->YAB1                               <---------AHL12(1)    <---------ANAC58
------>GLK1(2)   --------->ICU4                             <------ZmHOX2a(1)   ------>ZmHOX2a(1)---
------GLK1(1)    <---------ATHB12       --------->AtMYB61  ----------->GT1<---------MYB46(3)<-------
 
aatctgcattttgaaacccgatgatgaggaagaaatggagtcaccatcaccatcgaaaacagaggaaaatttaggcgtggttcctctgtcttgcgcgttt  12624000
                            --------->DOF5.7(1)
                          ---------->DOF2
                --------->ARR11(2)
    --------->ANAC58    --------->ANAC58                                                     -------
    --------->ANAC58--------->LBD16                                       <-----------GT1   <-------
------>ANAC55(2)<---------ARR11(2)                                      <----------DOF2     <-------
--->ARR14(2)    --------->ARR14(2)                                     --------------->AtSPL8<------
----ARR14(2)    <---------ARR14(2)                            <---------DOF5.7(1)         ----------
--->ARR11(2)  <----------DOF2                                 --------->TOE2(3)         ------------
----ARR11(2) <---------ANAC58                 <---------HSFB2a(2)    <-----------GT1   --------->KAN1
-->DOF5.7(2) <---------ANAC46                 --------->HSFB2a(2)   <<<<<<<<<<GT-3b <---------MYB52(1)
------>ANAC46<---------ANAC58        ----------->ARR10   --------->At4g35610     <---------YAB5   <-
---DOF2 <---------KAN1  --------->ANAC58--------->GLK1(2)<---------At4g35610 --------->TOE2(3)------
 
acgagacaagaacattgcgtttccgagacgaaagaacgcgaagaatcgactagaagactaagcagccttatttttctttacctcatcgttatgtccgtac  12624100
<- Previous    Next ->

AGI:  At2g29410.1   
Description:  MTPB1; efflux transmembrane transporter/ zinc ion transmembrane transporter. Identical to Metal tolerance protein B (MTPB) [Arabidopsis Thaliana] (GB:Q6DBM8;GB:Q9ZW23); similar to MTPA2, efflux transmembrane transporter/ zinc ion transmembrane transporter [Arabidopsis thaliana] (TAIR:AT3G58810.1); similar to MTPA2, efflux transmembrane transporter/ zinc ion transmembrane transporter [Arabidopsis thaliana] (TAIR:AT3G58810.2); similar to unnamed protein product [Vitis vinifera] (GB:CAO21568.1); contains InterPro domain Cation efflux protein; (InterPro:IPR002524)
Range:  from: 12623641    to: 12625064    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version