AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                  <---------At4g35610
                                                  <---------ZAT2
                                             --------->WOX13(2)
                                             <---------WOX13(2)
                                          <---------ATHB12
                                         --------->ANAC58
                                      <---------ZAT14
                                      --------->ZAT18
   <-----------GT1           ------->TEIL--------->ANAC46                            --------->YAB5
<---------DOF5.7(1)    ----------->HVH21 --------->ANAC58          <---------ETT(2) --------->ICU4
->AtSPL8        --------->AHL20(2)    <---------ZAT18            --------->YAB5     <---------YAB1
->AtSPL3        <---------AHL20(2)    --------->ZAT14     ----------->GT1    ---------->DOF2    <---
 
cccgttttacaattcatatttaaaatttgacggacctatagtccactcaatttagctggtattgtaaatgtctacaaaatgaaagtcatgaatacatttt  10301000
                                                                                <------MYB83
                                                                                ----------->GT1
                                                                                <------MYB46(1)
                                                                             =======================
                                                                        ============================
                                                                        <------ZmHOX2a(1)
                                                                     <---------HSFB2a(2)
                                                                  <---------ARR11(3)
                                      <-------MYC2                --------->ARR11(3)
                                      <-------MYC4                --------->RVE1(2)
                                      <-------MYC3             --------->AHL25(2)
               <---------AHL20(2)     ------->MYC3             <---------AHL25(1)
              --------->AHL25(3)      ------->MYC2             <---------AHL12(2)                  <
              <---------AHL20(2) --------->AtLEC2              --------->AHL12(3)               ----
       <-------TEIL              --------->ANAC58              --------->AHL20(2)             ------
   --------------->AtSPL8        --------->ANAC58              --------->YAB1<------ZmHOX2a(1)<-----
   <---------------AtSPL3    <-----------HVH21    ---------->ID1 --------->CCA1(1)           -------
  ---------->DOF2         <---------At4g35610    <-------GAMYB <---------AHL25(3)           <-------
--------GT1  --------->AHL12(2) --------->WOX13(1)<---------MYB52(1) --------->HSFB2a(2)  --------->YAB1
 
cacttcaaagtacgttttttatttgtttgagatgtcaagcacatgtttatttcgttgttttccaaataatatctaggagaggaaggttatcaactatgat  10301100
                                                                                  --------->SPL7(1)
                                                                               --------->ANAC58
                                 ----------->HVH21                             --------->ANAC58
   <----------DOF2             --------->bZIP60(1)                             --------->ANAC55(1)
  <---------DOF5.7(1)          <---------bZIP60(1)                             <---------ANAC55(2)
===HOX2a_HOX2a           --------->ATHB12                                      --------->ANAC55(2)
===HOX2a_HOX2a          <---------KAN1                                         --------->ANAC46
---------CCA1(2)    --------->ANAC55(2)                         --------->TOE2(2) ------->TEIL
-->ZmHOX2a(2)       --------->ANAC58                          >>>>>>>>>MYB98  --------------->AtSPL3
--->ARR11(3)        --------->ANAC58               --------->TOE1(2)        <---------REM1(2)
----ARR11(3)        <---------ANAC55(2)<-----------HVH21  <----------DOF2 <---------ZAT14        <--
-->YAB1             XXXXXXXXXXXXXXXXXXXX>MIR864-5P --------->TOE2(2)      --------->ZAT14        ---
--YAB1          <-----------HVH21<---------ZAT14<---------CCA1(2)  ----------->HVH21  ----------->GT1
 
ctctatctttctagtttgtggtcacgcatgagtgacttcaccggtcatttcataccttcgactttaacatatgacactgtacacgtaccatgttaaaaat  10301200
                                                                                   -------->HAHB4
                                                                                   --------->YAB1
                                                                                  <---------YAB1
                                                                                 --------->AHL25(2)
                <---------HSFB2a(2)                                              <---------AHL20(3)
                --------->HSFC1(1)                                               --------->AHL20(3)
           <---------DOF5.7(1)                                                  --------->YAB1
           <----------DOF2 <---------MYB52(1)                                --------->TOE1(3)
          <---------DOF5.7(1)                                                --------->YAB1
          <---------------AGL15                                              --------->TOE2(3)
          <---------DAG2  <---------DAG2                                  ------>MYB83
          --------------->AGL15                                           ------>MYB46(1)
         ----------------->AGL2                                         <---------MYB46(2)
         <-----------------AGL3                                         <---------MYB59
         ----------------->AGL3 <---------AHL20(2)                  ----------->HVH21
       <-----------GT1    <---------DOF5.7(1)                     --------->bZIP60(1)
  <---------RVE1(2)      <---------DOF5.7(1)            --------->RVE1(2) --------->MYB52(1)
  <---------ARR11(2)<---------GLK1(1)             <---------KAN1  <---------bZIP60(2)     --------->AtLEC2
-------ANAC46   --------->HSFB2a(2)         --------->RVE1(2)     <---------O2 <---------YAB1
------>ALFIN1   <---------HSFC1(1)<---------RVE1(2)--------->YAB5 <---------bZIP60(1) ------------>CBF
 
gtgtggatagtaaccttttctagaaacccccttatttgatttttgtatatcgaatgacaaatccatgtgatgtgacctaaccataataatacaatgcaaa  10301300
                                                                                         -------->HAHB4
                                                                                         --------->YAB1
                                                                                        <---------YAB1
                                                                            <---------ANAC55(1)
                                                                ----------->RAV1(2)    --------->AHL25(2)
                                                                --------->At4g35610    --------->AHL20(3)
                                                                <---------At4g35610    <---------AHL20(3)
                                  --------->DAG2              <---------ALFIN1        --------->YAB1
                                 ---------->DOF2  --------->AHL12(3)        --------->ANAC55(2)
                             --------->TOE2(3)    <---------AHL12(3)        <---------ANAC55(2)
                             --------->TOE1(3)    ----------->TBP ----------->HVH21--------->YAB1  <
            ------>NtERF2    <---------MYB59      --------->AHL20(2)        <---------ANAC58     ---
      --------->KAN1   --------->YAB5            <---------AHL20(1)         <---------ANAC58     <--
   <---------ANAC55(2) --------->YAB1            --------->AHL20(1)         <---------ANAC46    ----
   --------->ANAC55(2)<---------YAB1       ----------->GT1   <-------TEIL  <-----------------------TaNAC69(2)
 
actaaaacgtgattcggccaaaactatgacaacctaaaaagctagagagtaatatatatagacatacacctgaagagttacgtatagcataataatacat  10301400
                                                                <---------HSFB2a(1)
                                                                <---------HSFC1(2)
                                  --------->ALFIN1              --------->HSFC1(2)
                                <---------At4g35610         --------->DOF5.7(1)                  <--
-----------------AGL1         <-----------RAV1(2)     <---------MYB52(1)                      ------
------>KAN1 <---------ALFIN1 <-------TEIL            <---------DOF5.7(1)                  <-------TEIL
-------AHL20(2)   ------>ZmHOX2a(1)               <---------ZAT18                        --------->AtLEC2
----->AHL25(3)  ----------->RAV1(2)         --------->YAB1<------ZmHOX2a(1) ------>ZmHOX2a(1)<------
 
ttattcaatatggccactctcctgcaaataggttcaggtgtgatttatagtaatgcccttaggaagacgcttcgacgtcctcagtcttctacatgcatca  10301500
                     --------->ICU4
                ----------->GT1
           --------->ANAC46
           --------->ANAC58
         <xxxxxxxxxxxxxxxxsmallRNA(s)        <---------ARR11(2)
      <---------ARR11(2)                     --------->ARR11(2)
      --------->ARR14(2)               <---------At4g35610
      --------->ARR11(2)            --------->ZAT14
-------ICU4--------->ANAC58   ----------->RAV1(1)
--->YAB1 --------->AtMYB61    <---------ALFIN1                                           ------>ZmHOX2a(1)
---YAB5<xxxxxxxxxxxxxxxxsmallRNA(s) <---------ZAT14<---------ZAT18          --------->AtMYB61   <---
 
tagtgaccgaaaccacaccatgtaataagtctcccacagttcagcgtcgttctgcgaactatcagccttctcgttgggaccatcaccatctcctctcggt  10301600
               <---------ANAC55(2)
               <---------ANAC46
              --------->SPL7(1)
              <-------TEIL
          --------------->AtSPL3
          <---------------AtSPL8                                                               -----
         <---------LBD16                                                                   ---------
     --------->WOX13(2)                                                           <---------AHL25(3)
    <---------AHL12(2)                                                            <---------AHL25(1)
    <---------AHL12(3)                                                            <---------AHL25(2)
   <---------AHL25(2)                                                             --------->AHL20(1)
   <---------AHL25(3)                                                             --------->AHL25(2)
   --------->AHL12(3)                                                             --------->AHL20(2)
   <---------AHL20(2)                                                             <---------AHL20(2)
   --------->AHL20(2)                                                             --------->AHL12(1)
   --------->AHL20(1)                                                             <---------AHL12(1)
   <---------AHL20(1)                                                            <---------AHL12(3)
   <---------AHL12(3)                                 <---------ANAC46           --------->AHL25(3)
   --------->AHL25(1)                                 <---------ANAC58           <---------AHL25(2)
   --------->AHL25(3)                                 <---------ANAC55(2)        <---------AHL12(1)
   --------->AHL12(1)                                 --------->ANAC58           --------->AHL12(1)
   <---------AHL12(1)        --------->ARR11(2)       --------->ANAC58           --------->AHL12(3)
   <---------AHL25(1)      --------->LBD16            --------->ANAC55(2)       --------->AHL12(2)
   --------->AHL25(2)     <---------ANAC55(2)         <---------bZIP60(1)       <---------AHL12(2)
  <---------AHL12(3)      --------->ANAC55(2)         --------->bZIP60(1)      --------->AHL12(3)
  <---------AHL25(1)     <---------LBD16              <---------TGA2(1)        <---------AHL12(3)
  --------->AHL12(1) --------->KAN1                   --------->TGA2(1)        <---------AHL12(2)
  --------->AHL20(2) <---------GLK1(1)                <---------ANAC58         --------->AHL12(2)
  --------->AHL25(1) --------->GLK1(1)               ----------->STF1         --------->AHL12(1)   -
  <---------AHL20(2)<---------RVE1(2)              ----------->HVH21          <---------AHL12(1)   <
  --------->AHL12(3)--------->ARR11(3)             ----------->TGA1           --------->AHL20(2)  <-
  <---------AHL12(1)<---------ARR14(2)        <-----------GT1                 <---------AHL20(2)<---
  --------->AHL25(3)<---------ARR11(3)   <----------DOF2                      --------->AHL25(3)----
 --------->AHL12(2) --------->ARR14(2)   <---------DAG2    --------->ICU4 ----------->GT1  <--------
------ETT(2)<---------SPL7(1)<---------ARR11(2)<---------At5g28300        <---------YAB1  ----------
 
cgaaaataaatttgcggtacgtagatatcccgtaaacactctaacttttttacagtgacgtaatgttgaatactatgttgataaattttttgtaatgttc  10301700
------------>AGL3         --------->SPL7(1)                             <---------ICU4
>KAN1                   <---------SPL7(1)                      <---------GLK1(2)
-------->ARR11(3)    --------->DOF5.7(1)                      --------->KAN1
---------ARR11(3)   --------->DOF5.7(1)             --------->DOF5.7(1) --------->YAB5
--------CCA1(2)    ---------->DOF2                  --------->DAG2      --------->YAB1
------------AGL15  --------->DOF5.7(1)             --------->DOF5.7(1) <---------ATHB12
----------->AGL15--------->CCA1(2)                 ---------->DOF2     --------->ICU4
-YAB5         ----------->GT1           <---------MYB46(3)   --------->DOF5.7(1)             <------
----->AtSPL8---------->DOF2          <---------RVE1(2)     ---------->DOF2      ---------->DOF2
 
catatattgcatacagaaagataaaagggtacgagagagagatttgttgaaggaaaaagtgagaaagatgctcaatgatgagcaaaagacttatcttgac  10301800
                <------ZmHOX2a(2)
               --------->ARR11(2)
               <---------ARR11(3)
               <---------ARR14(2)
               --------->ARR14(2)
               <---------ARR11(2)
               --------->ARR11(3)
               --------->RVE1(2)
               --------->GATA12
               <---------GATA12
           >>>>>>>>>WRKY18               --------->YAB1
         <---------WOX13(1)             <---------YAB5              --------->AHL20(2)
        <---------WOX13(2)          <---------ANAC58          ----------->RAV1(1)
        --------->WOX13(2)          <---------ANAC58   --------->GLK1(1)       <---------YAB1
       --------->ATHB12     <---------LBD16           <---------ARR11(2) --------->ARR11(3)
      <-------TEIL         <---------LBD16        <---------At4g35610 <-----------GT1   --------->DOF5.7(1)
    <---------GLK1(1)   --------->KAN1  <---------YAB1<---------ARR14(2) <---------ARR11(3)     ----
---WRKY18(1)<---------TOE2(3)    --------->GLK1(1)--------->At4g35610<-----------GT1  ---------->DOF2
 
caattggagttcattgacgatctacaaaaactcggggtttcttatcattttgaagcggaaatcgacaacattttaacatcttcttataaaaaagatagaa  10301900
<- Previous    Next ->

AGI:  At2g24210.1   
Description:  TPS10 (TERPENE SYNTHASE 10); myrcene/(E)-beta-ocimene synthase. similar to ATTPS-CIN (TERPENE SYNTHASE-LIKE SEQUENCE-1,8-CINEOLE), myrcene/(E)-beta-ocimene synthase [Arabidopsis thaliana] (TAIR:AT3G25830.1); similar to myrcene/ocimene synthase, putative [Arabidopsis thaliana] (TAIR:AT3G25810.1); similar to ATTPS-CIN (TERPENE SYNTHASE-LIKE SEQUENCE-1,8-CINEOLE), myrcene/(E)-beta-ocimene synthase [Arabidopsis thaliana] (TAIR:AT3G25820.1); similar to pinene synthase [Quercus ilex] (GB:CAK55186.1); contains InterPro domain Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (InterPro:IPR008930); contains InterPro domain Terpene synthas
Range:  from: 10301410    to: 10304610    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version