AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                         --------->CCA1(2)
                                                      <---------TOE2(3)
                                                      <---------YAB1
                                              --------->ALFIN1
                                             --------->LBD16
                                            <---------O2<---------ARR11(3)
                                            <---------ANAC46
                            ------>MYB83    <---------TGA1a
                    --------->HSFB2a(2)     --------->DEAR3(1)
                ------>ZmHOX2a(2)           --------->TGA1a
              --------->GATA12              <---------ANAC58
              <---------RVE1(2)             <---------ANAC58                                      <-
              <---------ARR11(3)          <---------RAP2.3(1)         --------->MYB46(3)          --
   <---------At4g35610      ------>MYB46(1) --------->O2--------->GATA12                          --
   --------->At4g35610    --------->TOE1(2)<------NtERF2--------->ARR11(3)                  <-------
-->ZmHOX2a(1) --------->ARR11(3)          ------>NtERF2 <---------GATA12          <---------AHL20(2)
 
tcaggcctctgaaacttgatcttctcaaacctgccaatagcattgcgccgtgggattaagatttacacaaacaaacaccgagtttttaatggattaagaa  27291600
                                            --------->DAG2
                                           ---------->DOF2
                                          <---------MYB52(1)
                                         --------->At5g28300
                                <------ZmHOX2a(2)
                                --------->CCA1(2)
                               --------->ARR11(3)
                               <---------ARR11(2)
                               --------->ARR11(2)
                               <---------ARR14(2)                            --------->WRKY38(1)
                               <---------ARR11(3)                            --------->WRKY12
                               --------->AGP1----------->GT1               <---------At4g35610
                       <<<<<<<<<GATA-1  <---------ANAC46          <---------ICU4           <--------
               <---------ANAC46--------->ARR14(2)             ------->GAMYB--------->At4g35610
               <---------ANAC55(1)    ------->GAMYB          <---------MYB52(2)            <-------GAMYB
               <---------ANAC58<---------GATA12              --------->MYB46(3)         <---------ZAT14
               --------->ANAC55(2)   --------->ANAC46       <---------WOX13(2)>>>>>>>>>>WRKY11
---------DOF2 <-----------------------TaNAC69(2)            <---------At4g35610         --------->ZAT14
------->TOE1(3)<---------ANAC58--------->GATA12     --------->GLK1(2)--------->YAB5<---------YAB1
------->TOE2(3)<---------ANAC55(2)   --------->DEAR3(1)     --------->WOX13(2)>>>>>>>>>>WRKY6
--TOE2(3)    <-----------GT1   --------->RVE1(2)<-----------GT1--------->MYB52(1)  <---------TOE2(3)
 
actttaacagaagaaattacgtgtttatctataagatccaacgccgtaaagtaacaatctttcaactaacaatgacacagttgactaacattgcagttga  27291700
                        ------>ZmHOX2a(1)
                     ------>ZmHOX2a(1)
                   ------>ZmHOX2a(2)
                  =============HOX2a_HOX2a
                 <---------RVE1(2)
                 --------->AGP1--------->GATA12
                 <---------ARR11(2)
                 --------->GATA12
                 --------->ARR11(2)
                 <---------GATA12
                 --------->ARR14(2)                                                              ---
                 <---------ARR14(2)                                                              <--
                 <---------ARR11(3)                           ---------->DOF2               --------
               ----------->ARR10  --------->AHL20(2)       --------->ANAC58                 --------
    --------->YAB5<------ZmHOX2a(2)    --------->DOF5.7(1) --------->ANAC58          --------->ANAC58
   <---------YAB1<---------GLK1(2)<---------AHL20(2)   --------->TOE2(3)         --------->At4g35610
 ----------->GT1 --------->ARR11(3)  ---------->DOF2   --------->TOE1(3)         <---------At4g35610
-At4g35610  --------->RVE1(2)  <---------GATA12      ------->TEIL  --------->CCA1(2) --------->ANAC58
 
tgaattgtgattacaaatcagatcctcctaagtagatttaaaaagaagaaactttgaacctcaagtaaagaaatgggaacagagagctacgaaaacccta  27291800
                   <---------ARR11(2)
              --------->MYB52(1)
             <---------ARR14(2)
             --------->ARR11(2)
             <---------ARR11(2)
        ---------->DOF2
       <---------KAN1
    --------->LBD16<---------GLK1(2)
   --------------->AGL15
   <---------------AGL15
  <---------LBD16  <---------ARR14(2)
 --------->MYB52(1)--------->ARR11(2)
 <---------At5g28300                                                                            ----
<-----------GT1    --------->ARR14(2)                                                           <---
------>WOX13(2) --------->ANAC58                                     <---------ZAT14          <-----
-------WOX13(2) --------->ANAC58                         <------ZmHOX2a(1)                    <-----
->TOE2(3) <---------TOE2(3)                          --------->DOF5.7(1)     ------>NtERF2 ---------
->TOE1(3)--------->DAG2                  --------->MYB52(1)   --------->At4g35610        ---------->DOF2
 
aatttaccggataaaggaaacggaatcggagtcggaagtgaagttatcggagggagaagaggagtagatgccttcactgccaccatggaagacaaaggcg  27291900
             <---------KAN1
         --------->ANAC58
         --------->ANAC58
         --------->ANAC46
 <----------DOF2                          <---------ANAC46
----->DOF5.7(2)                           <---------ANAC58
------MYB52(1)                            <---------ANAC58
----ANAC58  --------->GLK1(2)        --------->DEAR3(1)                        >>>>>>>>>TBF1--------
----ANAC58  ------->TEIL           ------->TEIL      ---------->DOF2       --------->At4g35610
>DOF5.7(1) <---------GLK1(2) <---------YAB5      <----------DOF2--------->CCA1(2)  --------->DOF5.7(1)
 
ttacctttagacacgaatctctcgcttcggtactcatgcaccgatgcttgaactttcaaagaagaagatagacatagcagaagaagaagatggagcaaca  27292000
                                --------->DOF5.7(1)
                              ---------->DOF2
                             *TSS
                        =====================HOX2a_HOX2a
                        ------>ZmHOX2a(2)
                       --------->CCA1(2)
                       ======================HOX2a_HOX2a
                       --------->At4g35610
                       <------ZmHOX2a(2)
                      --------->ARR14(2)
                      <---------ARR11(3)
                      <---------ARR14(2)
                      --------->GATA12               <---------YAB1
                      --------->AGP1               --------->At4g35610
                      --------->ARR11(3)        <---------At4g35610                    <-----------HVH21
                      <---------AGP1            --------->At4g35610                --------->GATA12<
                      <---------RVE1(2)         <---------ZAT2               --------->At4g35610   <
                      <---------GATA12     --------->DOF5.7(1)               <---------At4g35610   <
   --------->ANAC46  <---------GLK1(1)   ---------->DOF2                     <---------ZAT2        <
--->RAV1(1)          --------->GLK1(1)<------ZmHOX2a(1)       >>>>>>>>>TBF1  --------->ZAT2       <-
 
ttgtaaacccaattcgttgcagagagatctgaagaaagagaggagaaagagagctgatgactgaagaagaagtcagtgagagctgagatgtgtcaaatgg  27292100
                       <------------CBF
                      --------->ATHB12
             <---------At4g35610
          --------->RAP2.6(3)
          --------->SPL7(1)                   <---------ARR11(3)
        ----------->HVH21                     <---------GATA12
        <---------SPL7(1)                     --------->GATA12
       ------>ZmHOX2a(2)                   <-----------RAV1(2)                                  ----
     <---------RVE1(2)<---------ICU4 --------->KAN4(2)                                   --------->ARR11(2)
---------DEAR3(2)    <---------YAB5 --------->YAB5                                      <-------GAMYB
------MYB83<---------DEAR3(1)       <---------ICU4                                     ----------->GT1
---------MYB46(3)  ---------->DOF2  --------->KAN1                              --------->WOX13(2)
------MYB46(1) <---------MYB46(3)  <---------YAB5                               <---------WOX13(2)
--------DEAR3(1)<-------GAMYB      <---------YAB1 <-------TEIL               <---------MYB59   <----
 
gtcggtttgatcggacggctgttaaagattgctccttgatcattctccagatgttcatgtgttccaagtgaagcctctagcctaattagagggttacact  27292200
                                                              <---------WOX13(1)
                                                            --------->ATHB12
                                                            <---------ICU4
                                <---------TOE2(3)           --------->ATHB51
                    <---------AHL25(1)                      -------->ATHB1
                    --------->AHL12(3)                      <--------ATHB1
                    <---------AHL12(3)                      --------->YAB1
                    <---------AHL20(2)                      --------->YAB5
  ----------->GT1  <---------AHL20(1)                      --------->ICU4
  --------->ANAC55(2)      <---------RVE1(2)               <---------ATHB12                       <-
  --------->ANAC58 --------->AHL25(3)                      <---------ATHB51                   <-----
  --------->ANAC58 --------->AHL20(1)           <---------ANAC46  <----------DOF2             <-----
  <---------ANAC55(2)  <-----------GT1          <---------ANAC58 <---------ANAC58    --------->YAB1
----->ZAT14     --------->AHL20(2)<------ZmHOX2a(1)     ------------>ATHB5   <---------------AtSPL8
------DOF2   <----------DOF2<----------DOF2     <---------ANAC58 <---------ANAC58 --------->WOX13(1)
 
ttagtaagtaacaaaacttttatatatttcgattttaggatgggccttcgttcgtgtgtccaataattgctttgtgaaatatggtccatcaaaactggat  27292300
                                                                                              <-----
                                                                                              <-----
                                                                                             <------
                                                                                             -------
                                                                                            --------
                                                                                            --------
                                                                                            --------
                                                                                            <-------
                                                                                            <-------
                                                                                            <-------
                                 ----------->GT1                                            --------
                            ------>MYB46(1)                                             <---------AHL25(3)
                            ------>MYB83                                                --------->AHL20(2)
                          <---------------AGL15                                         <---------AHL12(3)
                          <---------MYB59                                               <---------AHL20(2)
                         ----------------->AGL2                                         --------->AHL12(3)
                         ----------------->AGL3                                         --------->AHL25(1)
                         <-----------------AGL2                                         <---------AHL25(1)
                         <-----------------AGL3                                        <---------AHL20(2)
                    --------------->AtSPL8                                           --------->WOX13(2)
        <---------AHL20(2)--------------->AGL15                                      <---------WOX13(2)
 <----------DOF2  <---------ANAC55(2)        <---------YAB1                          --------->AHL12(2)
----------GT1     --------->ANAC55(2)       <---------AHL25(2)                     <---------AHL20(2)
----GATA12       <-------TEIL --------->YAB1--------->AHL25(2)   ----------->GT1   --------->AHL25(1)
----RVE1(2)  <---------------AtSPL8     ----------->GT1   ----------->GT1        <----------DOF2
 
tttactttcattttatgaagtacgtagtaccaaatatagttaatagttatatttgaagaatgggtttatagttaatagttatagctttaatttatataaa  27292400
                                                                                              ------
                                                                                              <-----
                                                                                              ------
                                                                                              ------
                                                                                              <-----
                                                                                              <-----
                                                                                              <-----
                                                                                            <-------
                                                                                            <-------
                                                                                            --------
                                                                                           <--------
                                                                                           <--------
                                                                                           ---------
                                                                                           ---------
                                                                                           <--------
                                                                                        <---------ANAC46
                                                                                        <---------TOE2(3)
                                                                                       <---------LBD16
                                                                                      <-----------GT1
                                                                                      --------->MYB52(1)
                                                                                   --------->WOX13(2)
                                                                                   <---------WOX13(2)
                                                                                   --------->AHL12(2)
                                                                                   <---------AHL12(2)
                                                                                  --------->AHL25(1)
                                                                                  --------->AHL20(3)
                                                                                  --------->AHL25(2)
                                                                                  --------->AHL12(3)
                                                                                  --------->AHL20(2)
                                                                                  <---------AHL20(2)
                                                                                  <---------AHL20(3)
                                                                                  <---------AHL12(3)
                                                                                  <---------AHL25(3)
                                                                                 <---------AHL20(1)
                                                                                 <---------AHL25(2)
                                                                                 --------->AHL20(1)
                                                                                 <---------AHL20(2)
                                                                                 --------->AHL25(2)
                                                                                 <---------AHL25(3)
                                                                                 --------->AHL25(3)
                                                                                 <---------AHL12(1)
                                                                                 --------->AHL20(2)
                                                                                 <---------AHL25(1)
                                                                                 --------->AHL25(1)
         --------->AHL20(2)                                                      --------->AHL12(1)
         <---------AHL20(2)                                                      --------->AHL12(3)
   --------->AHL12(2)                                                           --------->AHL25(3)
---------->ID1                                                                  --------->AHL12(3)
----AHL20(2)                                                                    <---------AHL25(2)
----AHL20(3)                                          <---------AHL25(3)        <---------AHL25(1)
---AHL25(3)                                           <---------AHL20(2)        --------->AHL20(3)
-->AHL25(3)                                          --------->AHL25(3)         <---------AHL20(3)
->AHL12(3)                                       --------->AHL20(1)             <---------AHL12(3)
->AHL20(2)                                       --------->AHL20(2)             --------->AHL20(2)
->AHL25(1)                                       <---------ARR11(3)             <---------AHL20(2)
--AHL25(1)                              <-----------GT1        --------->ZAT6  --------->AHL12(2)
--AHL20(2)                     <---------ZAT6    <---------AHL20(1)--------->YAB1<---------AHL12(3)
--AHL12(3)             <---------YAB1--------->WOX13(2)   ----------->GT1      <---------WOX13(2)
->AHL25(3)        --------->KAN1   <---------AHL20(2)--------->AHL20(2)        --------->WOX13(2)
 
tttgttttttttttaaatgttatattctcatttagtgtttattttacttctatatattaaatagttacactcatagtttctaaattaatttacggatatt  27292500
<- Previous    Next ->

AGI:  At1g72480.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G01070.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN62240.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO45597.1); contains InterPro domain Transmembrane receptor, eukaryota; (InterPro:IPR009637)
Range:  from: 27289720    to: 27292030    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version