AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                          ------>ZmHOX2a(1)            --------->ICU4
                     --------->ANAC46                  <---------YAB1
                 <-----------GT1                      --------->TOE2(3)
              --------->WOX13(2)                     --------->ATHB12
         --------->At5g28300                         <---------ICU4                               <-
        ----------->GT1   --------->AtLEC2           --------->YAB1               <---------KAN1<---
 <---------------AGL15  --------->SPL7(1)            --------->YAB5      <---------TOE2(3)  <-------
 --------------->AGL15<-----------HVH21             <---------ATHB12--------->ANAC58       <--------
---------At4g35610<-----------GT1         --------->At4g35610       --------->ANAC58       ---------
-------->At4g35610-------->P              <---------At4g35610       --------->ANAC46       <--------
 
acagctaaaaacagtaaaatttacccgtcctgcaaatgagaaaacagcagactaaatcattagtatgaaacaagcaaaggttagcatatgagtcagcttc  23476900
                                                                              ----------->GT1
                                                                           --------->ALFIN1
                                                                         <---------ANAC46
                                                                    ------>ZmHOX2a(2)
                                                                   <------ZmHOX2a(2)
                                                                  <---------ARR14(2)
                                                                  <---------ARR11(2)
                                                                  --------->ARR14(2)
                                                                  --------->AGP1
                                                                  --------->ARR11(2)
                                                                  --------->GATA12
                                                                  --------->RVE1(2)
----------RAV1(1)                                                 <---------ARR11(3)
-------DOF2                                                       <---------GATA12
--GLK1(2)                                                         --------->ARR11(3)
-At4g35610                 <-------TEIL                     --------->ANAC46----------->GT1
>At4g35610         --------->At4g35610             ----------->RAV1(1)------>ZmHOX2a(1)            <
-ZAT2    --------->KAN1   --------->CCA1(2)       --------->ANAC46<---------GLK1(2) --------->ZAT6 <
 
tttgttgttgtttcattctaagagcagagatacaagtttcacatttgaattccacaacattcaacaccagatcctagagtggagataatactatgaggca  23477000
                                                                           <---------ANAC46
                                                                           ----------->GT1
                                                                     --------->AHL20(2)
                                                                     <---------AHL20(1)
                                                                     --------->AHL12(1)
                                                                     --------->AHL20(1)
                                                                     <---------AHL12(1)          <--
                                                                     <---------AHL20(2)         ----
                                                                     --------->AHL20(3)         ----
                                                                     <---------AHL25(2)         ----
                                                                     --------->AHL25(2)        <----
                                                                     <---------ARR11(3)        -----
                                                                     --------->ARR11(3)        <----
                                                                     <---------AHL20(3)        -----
                                                                     <---------AHL25(1)        -----
                                                                     <---------AHL25(3)        <----
                                                                    --------->AHL12(1)         <----
                                                                    <---------AHL12(1)        ------
                                                                    <---------AHL25(1)       <------
                                                                    <---------AHL12(3) --------->AHL25(2)
                            --------->YAB1                          --------->AHL12(3) <---------AHL12(1)
        --------->GLK1(2)  <---------YAB5                           --------->AHL20(2) <---------AHL20(2)
        --------->RVE1(2)<---------ARR11(2)   <----------DOF2      --------->AHL12(2)  --------->AHL20(2)
  <---------WOX13(1)  --------->YAB1         --------->TOE2(3)----------->GT1          <---------AHL25(2)
--------->ATHB12     ---------->ID1  ----------->GT1      --------->ANAC58 <---------ANAC58  <------
---------YAB5    <----------DOF2  ---------->DOF2         --------->ANAC58 <---------ANAC58  -------
---------YAB1<---------GLK1(2) --------->RVE1(2) ---------->DOF2--------->AHL20(2)     --------->AHL12(1)
 
tagtgattgagaatcaaattctttatcgtattcatatcaaaggtgaaacctttatagcaccaagtaagtaaatatattgagtgaaatcaaaaaattgaga  23477100
                                                                                               -----
                                                                                              <-----
                                                                                              ------
                                                                                              ------
      >>>>>>>>>TBF1                                                                           <-----
-----TEIL                                                                                     <-----
----->ARR14(1)                                                                                ------
----->GLK1(2)                                                                                 ------
----->CCA1(2)                                                                            <------NtERF2
-----GLK1(2)                   --------->YAB1                                           ------>NtERF2
---->GATA12                    --------->TOE2(3)                                       --------->ANAC46
-----GATA12                   <---------YAB1                                          <---------LBD16
---->ARR14(2)               <-----------GT1                <------NtERF2              --------->LBD16
---->ARR11(1)             <-------GAMYB                   --------->ZAT18             <---------At4g35610
-----ARR14(2)            --------->MYB111(2)              ------>NtERF2               --------->At4g35610
-----RVE1(2)             <---------MYB46(3)               <---------ZAT18   <----------CDC5 --------
--->KAN1 >>>>>>>>>TBF1------------>MYB.PH3(2)       <---------WOX13(2)     --------->At4g35610<-----
---TOE2(3)           <---------TOE2(3)         --------->ANAC58      <------ZmHOX2a(2)------>NtERF2
---RVE1(2)           --------->DOF5.7(1)       --------->ANAC58 --------->RVE1(2)   ---------->CDC5
---->ARR10         ---------->DOF2<---------ICU4    --------->WOX13(2)--------->KAN1<---------LBD16
 
ttcggagaagaagaagaagctataaaggttgttaccataatgtccatgtgaagccaattggcgcccaaatcgatcatccgcttagcctccgcggcaagat  23477200
                                                                                                 <--
                                                                                                 <--
                                             --------->ANAC46                                    <--
                                             <---------ALFIN1                                    <--
                                            --------->MYB46(3)                                  <---
                                           --------->ANAC58                                     ----
                                           --------->ANAC46                                     ----
                                         <---------ALFIN1                                       ----
                                       <---------ALFIN1                                         ----
       --------->At4g35610            <------NtERF2                                             ----
       <---------At4g35610           ------>NtERF2                                             <----
      <---------TOE1(1)             --------->DEAR3(1)                                        <-----
---------->DOF2                  <---------DEAR3(1)                                          <------
---->CCA1(2)                  ------>ZmHOX2a(2)    <---------DOF5.7(1)                       <------
----GATA12                   --------->KAN1--------->ANAC58                             <---------KAN1
--->GATA12--------->YAB5     <------ZmHOX2a(2)  <---------ALFIN1                       --------->GLK1(2)
--->ARR11(3)                <---------GATA12<---------MYB55(2)          <---------YAB1 <---------GATA12
----ARR11(3)                --------->ARR11(3)------>MYB46(1)         <---------KAN1  <---------GLK1(2)
----ARR14(2)                --------->GATA12--------->DEAR3(1)       <---------ARR14(2)--------->ARR14(2)
--->ARR14(2)         --------->ANAC46----------->RAV1(1)             --------->ARR11(2)--------->ARR11(2)
--->ARR11(1)        <---------LBD16 ----------->HVH21                <---------ARR11(2)<-----------ARR10
--->ARR10----------->HVH21  <---------ARR11(3)------>MYB83           --------->ARR14(2)<---------ARR14(2)
----GLK1(2)  <xxxxxxxxxxxxxxxxxsmallRNA(fl3)<---------MYB111(2)    --------->YAB5  >>>>>>>>>TBF1----
 
ttgcaaagtccgatgacaacatcgacggagcgatcttcggcgacacacccaccatcttctctggtttcaacgaatatggtagagaagaagaatctgcgtt  23477300
    --------->ZAT18                                                          =======================
    <---------ZAT14                                                     <---------KAN1
    <---------ZAT18                                                    <---------ARR11(1)
    --------->ZAT14                                                    --------->GLK1(2)
   *TSS                                                                <---------GATA12
----MYB83                                                              --------->GATA12
----MYB46(1)                                                   --------->WRKY38(1)
-------ANAC46                                          <---------WRKY12<-----------ARR10
-------ANAC55(2)                       --------->AtMYB61       --------->WRKY12 --------->ANAC46
------MYB46(3)                        --------->MYB46(3)      --------->DOF5.7(2)      <---------At4g35610
----->MYB52(2)                        ------------>CBF <---------WRKY45--------->ARR14(2)       <---
----->MYB111(1)                      >>>>>>>>>>>>>>>>>LFY     <---------MYB52(1)----------->HVH21
----->MYB59                          <<<<<<<<<<<<<<<<<LFY-------->P    ------->TEIL    <---------ZAT2
----->MYB55(2)                     <----------ID1      <---------WRKY38(1)   -------->P--------->At4g35610
----->MYB46(2)                  --------->DAG2        --------->WRKY18(1)--------->RVE1(2)  <-------
-----MYB55(1)                   --------->DOF5.7(1)  <-----------HVH21 --------->RVE1(2)    <-------
----MYB52(1)                   --------->DOF5.7(1) --------->MYB59     <---------ARR14(2)  <--------
----DOF2                       ---------->DOF2  <------------CBF      <---------GLK1(2)--------->ZAT2
-----HVH21                --------->YAB1        --------->WOX13(2)    <---------ARR14(1)   ---------
----->MYB111(2)        <---------GLK1(1)        <---------WOX13(2)    <---------CCA1(2)--------->STY1(2)
 
aggtgagagcactgtgagaagagaagaaatcagaaaaagcgaccaatgggtaattgggtcaacccgttaacccgaatctcaacccgacccagctagcttg  23477400
                         ------>MYB46(1)
                         ------>MYB83
                       --------->AtMYB61
                       <---------MYB46(2)
                       <---------MYB111(2)
                       --------->MYB46(3)
                       <---------MYB111(1)
               <---------O2
               --------->TGA1a
               --------->bZIP60(1)
               <---------TGA1a
               <---------bZIP60(1)
               --------->O2
               <---------bZIP60(2)
               --------->ANAC55(2)
               <---------ANAC46
               <---------ANAC58
               <---------ANAC55(2)
               <---------ANAC58
       ----------->RAV1(2)--------->MYB46(3)
     ------>MYB46(1)  <------NtERF2
     ------>MYB83--------->ALFIN1
   <---------MYB59    --------->ANAC58
   --------->AtMYB61  --------->ANAC58
   --------->MYB46(3)------>NtERF2                           <---------ARR11(3)                  ---
=========================MYC_MYB                             --------->ARR11(3)             --------
------RVE1(2) ----------->bZIP910(1)               <---------ALFIN1                      <---------DOF5.7(1)
--ANAC58      ----------->STF1               --------->ANAC55(2)                       <-----------ARR10
--ANAC58     <---------TGA2(2)               <---------ANAC55(2)                       <---------ARR11(3)
-STY1(2)    ----------->HVH21   --------->ANAC58  --------->MYB46(3)                   --------->ARR11(3)
>STY1(2)    ----------->TGA1    --------->ANAC58--------->ARR11(2)                    <---------KAN1
 
atacgaccaaacctgatgacgtggcaccaaacaccaaggcaaactaatacataaccacttctaagaacttcacttacacattttgtcgaacatcttatct  23477500
                                                                                       <---------ICU4
                                                                                       --------->ATHB12
                                                                                      <---------YAB1
                                                                                    --------->YAB1
     ---------->DOF2                                                           <-------TEIL
     --------->MYB52(1)                   <-----------RAV1(2)               --------->YAB1     <----
   <---------MYB52(2)                   <-----------HVH21                  <---------YAB5      <----
--------->MYB46(3)                  ------->TEIL                          <---------WOX13(1)   <----
------>REM1(1)                   <---------YAB1      <---------YAB5    <---------YAB1 <---------YAB5
->RVE1(2)                      <---------KAN1 <<<<<<<<<<AtWER   <-------TEIL--------->YAB5   <------
 
acaacaactaaaggtattagtagagaaattgagcatatgaatgcatcaggcatagagtcatattacatacacatatgaatgatacattgatcattgatgc  23477600
                                                    --------->YAB1      <---------ANAC58
                                                    --------->YAB5      <---------ANAC46
      <---------WOX13(2)                           <---------YAB5       <---------ANAC58
      --------->WOX13(2)                          <---------WOX13(1)  <---------YAB1              <-
    <---------AHL20(2)              <---------AHL25(3)          <---------ICU4                   <--
-----ANAC46        ------->TEIL     <---------AHL20(2)          --------->ATHB12 --------->ZAT18----
-----ANAC58     <---------YAB1     --------->AHL25(3)          <---------YAB1    --------->ZAT14<---
-----ANAC58   --------->At4g35610  --------->AHL20(2)          <---------YAB5    <---------ZAT18<---
---YAB1       <---------KAN1 <---------YAB5--------->ANAC46  --------->YAB1 ---------->DOF2     <---
 
ttgtgagttaattgggcatatgaatgcatagagtcatattaaatacacacatgaatgataacattgatcattgatgcttgaaagttcacacattacacag  23477700
                                               --------->WOX13(2)
                                             <---------AHL25(3)
                                             <---------AHL20(2)
                                            --------->AHL20(2)
                                            <---------AHL20(1)
                                            --------->AHL20(1)
                                            --------->AHL20(3)
                                            <---------AHL25(1)
                                            <---------AHL20(2)
                                            --------->AHL25(3)
                                            <---------AHL25(2)
                                            --------->AHL25(1)
                                            <---------AHL20(3)
           <---------YAB1                  --------->AHL12(2)                 <---------KAN1
          <---------AHL20(1)               <---------AHL12(2)                 --------->CCA1(2)
     <---------MYB52(1)                   <---------AHL12(2)                 <---------ARR14(2)
    --------->TOE2(3)     ---------->DOF2 --------->WOX13(2)                 <---------ARR11(2)
  ---------->ID1       --------->ANAC46   --------->AHL12(2)                <------ZmHOX2a(1)
--------AHL12(1)       --------->ANAC58   <---------WOX13(2)               ----------->GT1     <----
-------RVE1(1)         --------->ANAC58  <---------AHL12(1)             --------->DOF5.7(1)    -----
----->ARR11(3)      <-------TEIL         --------->AHL12(1)            --------->DOF5.7(1)<---------HSFB2a(2)
------ARR11(3)   <---------ANAC58      <---------ARR11(3)   --------->WRKY38(1)  --------->AHL20(2)
------GLK1(2)    <---------ANAC58    <---------TOE2(3)<------NtERF2  ---------->DOF2      --------->HSFB2a(2)
------RVE1(2)   <---------------AtSPL8 --------->ARR11(3)   ----------->HVH21--------->ARR14(2)<----
 
attttttcgttaatatgtttgggtacaagtaaagcccaataagataatttaatgggccgagaattgacccatgaaaggaggatataaaatgttttagaaa  23477800
<- Previous    Next ->

AGI:  At1g63290.1   
Description:  ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative. similar to ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative [Arabidopsis thaliana] (TAIR:AT3G01850.2); similar to ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative [Arabidopsis thaliana] (TAIR:AT3G01850.1); similar to unknown [Populus trichocarpa] (GB:ABK96131.1); contains InterPro domain Ribulose-phosphate binding barrel; (InterPro:IPR011060); contains InterPro domain Ribulose-phosphate 3-epimerase; (InterPro:IPR000056); contains InterPro domain Aldolase-
Range:  from: 23475514    to: 23477304    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version