AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
        <----------DOF2
        <---------DAG2
  <------ZmHOX2a(1)
------AHL20(2)
------AHL25(3)
---->AHL12(1)
-----AHL12(1)
---->AHL20(1)
---->AHL20(2)
-----AHL20(1)
---->AHL25(2)
-----AHL20(2)
---->AHL25(3)
-----AHL25(2)                                                           ------->TEIL
-----AHL25(1)                        <---------GLK1(2)            <---------AHL20(2)
---->AHL20(3)                      --------->DOF5.7(1)            <---------ATHB51
-----AHL20(3)               ----------->RAV1(1)                  --------->WOX13(2)
---->AHL25(1)              <----------ID1                        <---------AHL12(2)
-->WOX13(2)            ------>ZmHOX2a(1)    <---------YAB1       --------->AHL12(2)        ---------
---WOX13(2)        ---------->ID1---------->DOF2                 <---------WOX13(2)     <---------ZAT18
 
tattaggagtactttttgttttgttcctaaacaacaaaaagattgttatgagtttaagcctatgtgtaaattatggaccttgatgtactattgcacacag  19809700
                                                        --------->GATA12
                                                        <---------GATA12
                                                        <---------AGP1
                                                        --------->RVE1(2)
                                     <---------bZIP60(1)<---------ARR14(3)
                                  <---------ATHB12      --------->ARR11(3)
                  ------>ZmHOX2a(1)--------->YAB1      --------->RVE1(1)
                  --------------->AGL15        --------->At5g28300
                  <---------------AGL15    <---------ICU4 ------>ZmHOX2a(2)
                 <-----------------AGL1    --------->YAB1<------ZmHOX2a(2)
                 <-----------------AGL3   --------->ICU4--------->ARR14(2)
        --------->YAB1        --------->MYB46(3)    ---------->DOF2
        ---------->DOF2      --------->ANAC58 ----------->GT1
        <---------ICU4---------->DOF2--------->bZIP60(1)<---------ARR14(2)
      <---------WOX13(2)     --------->ANAC58<---------YAB1  <---------AHL20(2)   <---------GATA12 <
 --------->ANAC58--------------->AGL15    <---------YAB5--------->ARR14(3)        --------->GATA12 -
 --------->ANAC58<-----------------AGL2 --------->YAB1--------->DOF5.7(1)  <---------AHL12(1)    ---
>ANAC46<---------ATHB12  --------->ANAC46 <---------YAB1<---------ARR11(3)<---------AHL12(2)   -----
 
tggcaggccaataaagacttcctcttaaaggcaaccaatgatatcatcatggtaaaaaagatcttaaatttgaaacaaattttcagattgaacttcaaac  19809800
                                                   ------->TEIL
                                                   --------->GATA12
                                              <---------ANAC46
                                              <---------ANAC58
                                         --------->AHL25(1)
                                         --------->AHL20(2)
                                         <---------AHL20(2)
                                         --------->AHL12(1)
                                         <---------AHL25(1)
                                         <---------AHL25(3)
                                         -------->ATHB1
                                         <--------HAHB4
                                         --------->ATHB51
                                         <---------AHL12(1)
                 <----------DOF2         <---------ICU4
                <---------DOF5.7(1)     <---------ATHB12
      <------ZmHOX2a(1)                 --------->AHL25(3)
      =================HOX2a_HOX2a      <---------ATHB51
  --------->TOE1(2)       --------->YAB1--------->ICU4
---------ZAT14  ------>ZmHOX2a(2)     --------->WOX13(1)                                   ---------
-------->ZAT14<---------ARR11(3)   --------->RVE1(2)     --------->RVE1(2)              --------->ANAC55(2)
------>ANAC46 --------->ARR11(3) <---------YAB1    <---------GATA12     --------->YAB1  <---------ANAC55(2)
---->ZAT6     <---------RVE1(2)<-----------GT1<---------ANAC58        <---------TOE2(3)<---------ICU4
 
actaaactaggaaaactgatctttagttttcatattactatcaattatttcttgaatctaaatcaaacaaactaatgaaaatgtttttaatacttatcta  19809900
                                   <---------AHL20(2)
                                  <---------YAB1
                                  --------->AHL25(3)
                                 --------->AHL12(3)
                                 <---------AHL25(2)
                                 --------->AHL25(2)
                                 --------->AHL12(2)                      --------->KAN1
                                 <---------AHL12(3)                   ------->TEIL
                <----------DOF2  <---------AHL12(2)                --------->AtLEC2
       <---------DOF5.7(1)      <---------ICU4                  --------->ICU4
      <---------DOF5.7(1)     --------->AHL12(2)           --------->ANAC46                        <
      <----------DOF2       <---------AHL20(2)        --------->RVE1(2) --------->ICU4      <-------TEIL
     <---------DOF5.7(1)    --------->AHL20(2)<---------At4g35610--------->YAB1           --------->TOE1(2)
 <---------GATA12         <----------DOF2     --------->At4g35610<---------ICU4         ------------
 --------->GATA12         --------->TOE2(3)   <---------ZAT2    <---------ATHB12        ------------
>RVE1(2)    <----------DOF2 --------->AHL25(3)--------->ZAT2    <---------YAB5     <----------------
 
tgtaaatctctttttctttctttcccaaactttaatttttatttttctgagctagcacatcaacgtaatcatgcacttattccaccagagaaacgtacaa  19810000
                                    <-----------GT1          --------->YAB1             *TSS
       --------->PCF5         <---------DAG2                <---------YAB1             <---------ANAC58
    --------->ALFIN1       <-----------GT1   --------->WOX13(2)                        <---------ANAC58
<<<<<<<<<<<<<<<<LFY   <-----------GT1     ------------>CBF --------->RVE1(2)       <------------CBF
--->AtSPL8          <----------DOF2<-----------GT1         <---------ARR11(3)     <---------ICU4
--->AtSPL3       ------>NtERF2<---------DOF5.7(1)          --------->ARR11(3)------>ZmHOX2a(1)
-----WRI1       --------->LBD16<----------DOF2        ------------>CBF      --------->TOE2(3)-------
 
gaacacagtggtccatctcccgactttacttcaccttttaaacccttcaatttcgtcaacaatatcatcaagtcccattcctcaaacattgcttaaccta  19810100
                         <----------DOF2
                        <---------DOF5.7(1)
                <---------MYB55(2)
                <---------MYB111(2)                                 ----------->GT1
                --------->MYB46(3)                             <------ZmHOX2a(1)
                <---------MYB52(2)                      ==============HOX2a_HOX2a
           ------>ZmHOX2a(1)                            <------ZmHOX2a(2)
   <-----------GT1 >>>>>>>>>>MYB80                     --------->ARR11(3)
<---------RVE1(2)------->GAMYB                         <---------ARR11(3)<---------ANAC55(2)    <---
-------->AGL15----------->RAV1(1)            <---------ANAC46 <----------ID1   ---------->DOF2  ----
 
ttagagtttccttcctccaacaaaccatctttataagactccaaaatggagggtaagagatcacaaggacaaggttacatgaaaaagaagtcttaccttg  19810200
                                                                                                  <-
                                                                                                 ---
                                                                                              <-----
                    <---------ANAC55(2)                                                       <-----
                   <---------LBD16                                                            <-----
                 <---------RVE1(2)                                                        <-------GAMYB
      --------->CCA1(2)                     <------MYB83                                 <---------MYB46(3)
     <---------ARR11(2)                     <------MYB46(1)                              --------->MYB52(2)
     --------->ARR11(3)                   <--------P                                   <---------ANAC58
     <---------RVE1(2)                  <------MYB83                                   <---------ANAC58
     <---------ARR11(3)                 <------MYB46(1)                                <---------ANAC46
     --------->ARR11(1)           <------ZmHOX2a(1)                            --------->YAB1<------
     <---------ARR14(2)       --------->DOF5.7(1)  <---------ZAT6             <---------ATHB12<-----
     --------->ARR14(2) <---------KAN1 --------->MYB59                      --------->WOX13(1)<-----
   ----------->ARR10--------->ANAC55(2)--------->MYB111(2)        <---------ZAT6 --------->ALFIN1<--
------HSFB2a(2)  <---------ARR11(2)    --------->MYB46(2)      <---------HSFB2a(2)    <------NtERF2
----->HSFB2a(2)  --------->ARR11(2)    --------->MYB111(1)     --------->HSFB2a(2)   <---------MYB46(3)
 
tggaagaagatatggagactgatacggatgaagaagaggaagtaggtagggatagagttagagggtctagaggtagcatcaatcgtggtggctcgttgcg  19810300
---------DOF2
------>ARR14(2)                 --------->DOF5.7(1)
----ANAC58                    ---------->DOF2
----RAP2.3(2)            <---------RVE1(2)
----ANAC58           <---------At4g35610                    ---------->DOF2
---LBD16             <---------ZAT2                   --------->ARR11(2)
----RAP2.6(2)        --------->At4g35610            --------->LBD16          --------->AtLEC2   <---
----ANAC46           --------->ZAT2----------->GT1<---------LBD16         <-------TEIL <---------At4g35610
-------ARR14(2) <-------TEIL<---------YAB1    <-----------HVH21 --------->ALFIN1---------->DOF2<----
 
gctttgccaagtagatagatgcacagctgatatgaaagaggcaaaactgtatcaccggagacacaaagtgtgtgaagttcatgcaaaggcatcttctgtc  19810400
                                               --------->SPL7(1)
                                               <-------TEIL<---------At5g28300                ------
                                            <---------ANAC46                                 <------
                                            <---------ANAC58                          ------>ZmHOX2a(2)
                                            <---------ANAC58                        --------->ARR11(3)
                                           --------------->AtSPL3                   <---------RVE1(2)
                                           --------------->AtSPL8                   <---------ARR11(3)
                                           <---------------AtSPL8                   <---------ARR11(2)
                    <----------DOF2       --------->MYB52(1)                        --------->ARR11(2)
                ------>MYB46(1)           <---------DOF5.7(2)                       --------->ARR14(2)
                ------>MYB83           <------MYB46(1) --------->WOX13(2)           <---------ARR14(2)
               --------->MYB52(1)      <------MYB83   ------>MYB83                  <---------AGP1
              ------->GAMYB            <---------ANAC55(2)<-----------GT1           --------->GATA12
             --------->MYB46(3)       --------->MYB59 ------>MYB46(1)               <---------GATA12
      <------ZmHOX2a(1)              <---------MYB55(1)<---------WOX13(2)          <---------CCA1(2)
-------DOF2  <---------MYB52(2)  <---------ZAT14    <---------MYB59      <----------DOF2   <--------
-----DOF5.7(1)--------->AtMYB61  --------->ZAT14    --------->TOE2(3)    <---------DAG2<----------DOF2
 
tttctctcaggacttaaccaacgcttttgtcaacaatgcagtaggtaacgtacaacctaatttacccttcaaaaaactttttgtctggatctttgaatgg  19810500
                                                                         --------->ZAT2
                                                                         <---------ZAT2
                                                                         --------->At4g35610
                                                                         <---------At4g35610
                                                                      <----------DOF2
                                                                     <----------CDC5
                                                                  --------->ATERF1(1)
                                                                  <------NtERF2
                                                                 <---------DEAR4(2)
                                                                --------->ALFIN1
                                                                <---------DEAR3(1)
      --------->ARR11(3)                                       <------ZmHOX2a(1)
----->GT1                                     <---------At4g35610<---------ATERF1(1)
---YAB5                                      ------->TEIL      --------->ATERF1(1)
-AtLEC2               --------->YAB1      <---------REM1(1) <-----------RAV1(2)
 
tttttttgagttcttgaaacaggtttcatgacctccaagagtttgatgaagctaagagaagttgcaggaggcgcttagctggacacaatgagcgaagaag  19810600
<- Previous    Next ->

AGI:  At1g53160.1   
Description:  SPL4 (SQUAMOSA PROMOTER BINDING PROTEIN-LIKE 4); DNA binding / transcription factor. Identical to Squamosa promoter-binding-like protein 4 (SPL4) [Arabidopsis Thaliana] (GB:Q9S7A9;GB:Q9SMX8); similar to SPL5 (SQUAMOSA PROMOTER BINDING PROTEIN-LIKE 5), DNA binding / transcription factor [Arabidopsis thaliana] (TAIR:AT3G15270.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO69773.1); contains InterPro domain Squamosa promoter-binding protein (InterPro:IPR017238); contains InterPro domain Transcription factor, SBP-box; (InterPro:IPR004333)
Range:  from: 19810089    to: 19810969    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version