AthaMap TU-Logo
Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
-----AHL25(2)                                                           ------->TEIL
-----AHL25(1)                        <---------GLK1(2)            <---------AHL20(2)
---->AHL20(3)                      --------->DOF5.7(1)            <---------ATHB51
-----AHL20(3)               ----------->RAV1(1)                  <---------AHL12(2)
---->AHL25(1)              <----------ID1                        --------->AHL12(2)
-->WOX13(2)            ------>ZmHOX2a(1)    <---------YAB1       --------->WOX13(2)        ---------
---WOX13(2)        ---------->ID1---------->DOF2                 <---------WOX13(2)     <---------ZAT18
tattaggagtactttttgttttgttcctaaacaacaaaaagattgttatgagtttaagcctatgtgtaaattatggaccttgatgtactattgcacacag  19809700
                                  <---------ATHB12      --------->ARR11(3)
                  <---------------AGL15        --------->At5g28300
                  --------------->AGL15    <---------ICU4 ------>ZmHOX2a(2)
                  ------>ZmHOX2a(1)--------->YAB1      --------->RVE1(1)
                 <-----------------AGL2    --------->YAB1<------ZmHOX2a(2)
                 <-----------------AGL3   --------->ICU4--------->ARR14(3)
        <---------ICU4        --------->MYB46(3)    ---------->DOF2
        ---------->DOF2      --------->ANAC58 ----------->GT1
      <---------WOX13(2)     --------->ANAC58<---------YAB1  <---------AHL20(2)   <---------GATA12 -
 --------->ANAC58--------------->AGL15    <---------YAB5<---------ARR14(2)        --------->GATA12 <
 --------->ANAC58<-----------------AGL1 --------->YAB1--------->DOF5.7(1)  <---------AHL12(1)    ---
>ANAC46<---------ATHB12  --------->ANAC46 <---------YAB1<---------ARR11(3)<---------AHL12(2)   -----
tggcaggccaataaagacttcctcttaaaggcaaccaatgatatcatcatggtaaaaaagatcttaaatttgaaacaaattttcagattgaacttcaaac  19809800
                 <----------DOF2         --------->AHL20(2)
                <---------DOF5.7(1)     <---------ATHB12
      <------ZmHOX2a(1)                 --------->AHL25(3)
      =================HOX2a_HOX2a      --------->ICU4
  --------->TOE1(2)       --------->YAB1<---------ATHB51
-------->ZAT14  ------>ZmHOX2a(2)     --------->WOX13(1)                                   ---------
---------ZAT14--------->ARR11(3)   --------->RVE1(2)     --------->RVE1(2)              <---------ANAC55(2)
------>ANAC46 <---------RVE1(2)<-----------GT1<---------ANAC58          --------->YAB1  --------->ANAC55(2)
---->ZAT6     <---------ARR11(3) <---------YAB1    <---------GATA12   <---------TOE2(3)<---------ICU4
actaaactaggaaaactgatctttagttttcatattactatcaattatttcttgaatctaaatcaaacaaactaatgaaaatgtttttaatacttatcta  19809900
                                 <---------AHL25(2)                      --------->KAN1
                                 <---------AHL12(3)                   ------->TEIL
                <----------DOF2  --------->AHL12(3)                --------->AtLEC2
       <---------DOF5.7(1)      <---------ICU4                  <---------YAB5
      <---------DOF5.7(1)     --------->AHL12(2)           --------->ANAC46                        <
      <----------DOF2       <---------AHL20(2)        --------->RVE1(2) --------->ICU4      <-------TEIL
     <---------DOF5.7(1)    --------->AHL20(2)--------->ZAT2    <---------ATHB12          --------->TOE1(2)
 <---------GATA12         <----------DOF2     --------->At4g35610<---------ICU4         ------------
 --------->GATA12         --------->TOE2(3)   <---------At4g35610--------->YAB1         ------------
>RVE1(2)    <----------DOF2 --------->AHL25(3)<---------ZAT2    --------->ICU4     <----------------
tgtaaatctctttttctttctttcccaaactttaatttttatttttctgagctagcacatcaacgtaatcatgcacttattccaccagagaaacgtacaa  19810000
                                    <-----------GT1          --------->YAB1             *TSS
       --------->PCF5         <---------DOF5.7(1)           <---------YAB1             <---------ANAC58
    --------->ALFIN1       <-----------GT1                 --------->ARR11(3)          <---------ANAC58
<<<<<<<<<<<<<<<<LFY   <-----------GT1     ------------>CBF <---------ARR11(3)      <------------CBF
--->AtSPL8          <----------DOF2<-----------GT1         --------->RVE1(2)      <---------ICU4
--->AtSPL3       ------>NtERF2<---------DAG2 --------->WOX13(2)              ------>ZmHOX2a(1)
-----WRI1       --------->LBD16<----------DOF2        ------------>CBF      --------->TOE2(3)-------
gaacacagtggtccatctcccgactttacttcaccttttaaacccttcaatttcgtcaacaatatcatcaagtcccattcctcaaacattgcttaaccta  19810100
                <---------MYB111(2)                                 ----------->GT1
                --------->MYB46(3)                             <------ZmHOX2a(1)
                <---------MYB52(2)                      ==============HOX2a_HOX2a
           ------>ZmHOX2a(1)                            <------ZmHOX2a(2)
   <-----------GT1 >>>>>>>>>>MYB80                     --------->ARR11(3)
<---------RVE1(2)------->GAMYB                         <---------ARR11(3)<---------ANAC55(2)    <---
-------->AGL15----------->RAV1(1)            <---------ANAC46 <----------ID1   ---------->DOF2  ----
ttagagtttccttcctccaacaaaccatctttataagactccaaaatggagggtaagagatcacaaggacaaggttacatgaaaaagaagtcttaccttg  19810200
                    <---------ANAC55(2)                                                       <-----
                   <---------LBD16                                                            <-----
                 <---------RVE1(2)                                                        <-------GAMYB
      --------->CCA1(2)                     <------MYB83                                 <---------MYB46(3)
     <---------ARR14(2)                     <------MYB46(1)                              --------->MYB52(2)
     --------->ARR11(1)                   <--------P                                   <---------ANAC58
     --------->ARR11(3)                 <------MYB83                                   <---------ANAC58
     <---------ARR11(2)                 <------MYB46(1)                                <---------ANAC46
     <---------RVE1(2)            <------ZmHOX2a(1)                            --------->YAB1<------
     <---------ARR11(3)       --------->DOF5.7(1)  <---------ZAT6             <---------ATHB12<-----
     --------->ARR14(2) <---------KAN1 --------->MYB59                      --------->WOX13(1)<-----
   ----------->ARR10--------->ANAC55(2)--------->MYB111(2)        <---------ZAT6 --------->ALFIN1<--
------HSFB2a(2)  --------->ARR11(2)    --------->MYB46(2)      --------->HSFB2a(2)    <------NtERF2
----->HSFB2a(2)  <---------ARR11(2)    --------->MYB111(1)     <---------HSFB2a(2)   <---------MYB46(3)
tggaagaagatatggagactgatacggatgaagaagaggaagtaggtagggatagagttagagggtctagaggtagcatcaatcgtggtggctcgttgcg  19810300
------>ARR14(2)                 --------->DOF5.7(1)
----RAP2.3(2)                 ---------->DOF2
----ANAC58               <---------RVE1(2)
----RAP2.6(2)        <---------At4g35610                    ---------->DOF2
---LBD16             <---------ZAT2                   --------->ARR11(2)
----ANAC58           --------->At4g35610            --------->LBD16          --------->AtLEC2   <---
----ANAC46           --------->ZAT2----------->GT1<---------LBD16         <-------TEIL <---------At4g35610
-------ARR14(2) <-------TEIL<---------YAB1    <-----------HVH21 --------->ALFIN1---------->DOF2<----
gctttgccaagtagatagatgcacagctgatatgaaagaggcaaaactgtatcaccggagacacaaagtgtgtgaagttcatgcaaaggcatcttctgtc  19810400
                                               --------->SPL7(1)                              ------
                                            <---------ANAC46                                 <------
                                            <---------ANAC58                          ------>ZmHOX2a(2)
                                            <---------ANAC58                        --------->ARR11(3)
                                           --------------->AtSPL3                   --------->ARR11(2)
                                           --------------->AtSPL8                   <---------ARR11(3)
                                           <---------------AtSPL8                   <---------ARR11(2)
                    <----------DOF2       --------->MYB52(1)                        <---------ARR14(2)
                ------>MYB46(1)           <---------DOF5.7(2)                       --------->ARR14(2)
                ------>MYB83           <------MYB83    --------->WOX13(2)           <---------RVE1(2)
               --------->MYB52(1)      <---------ANAC55(2)<-----------GT1           <---------AGP1
              --------->AtMYB61        <------MYB46(1)------>MYB83                  --------->GATA12
             --------->MYB46(3)       --------->MYB59 ------>MYB46(1)               <---------GATA12
      <------ZmHOX2a(1)              <---------MYB55(1)<---------WOX13(2)          <---------CCA1(2)
-------DOF2  <---------MYB52(2)  <---------ZAT14    --------->TOE2(3)    <---------DAG2<----------DOF2
-----DOF5.7(1)------->GAMYB      --------->ZAT14    <---------MYB59      <----------DOF2   <--------
tttctctcaggacttaaccaacgcttttgtcaacaatgcagtaggtaacgtacaacctaatttacccttcaaaaaactttttgtctggatctttgaatgg  19810500
      --------->ARR11(3)                                       <------ZmHOX2a(1)
----->GT1                                     <---------At4g35610<---------ATERF1(1)
---YAB5                                      ------->TEIL      --------->ATERF1(1)
-AtLEC2               --------->YAB1      <---------REM1(1) <-----------RAV1(2)
tttttttgagttcttgaaacaggtttcatgacctccaagagtttgatgaagctaagagaagttgcaggaggcgcttagctggacacaatgagcgaagaag  19810600
<- Previous    Next ->

AGI:  At1g53160.1   
Description:  SPL4 (SQUAMOSA PROMOTER BINDING PROTEIN-LIKE 4); DNA binding / transcription factor. Identical to Squamosa promoter-binding-like protein 4 (SPL4) [Arabidopsis Thaliana] (GB:Q9S7A9;GB:Q9SMX8); similar to SPL5 (SQUAMOSA PROMOTER BINDING PROTEIN-LIKE 5), DNA binding / transcription factor [Arabidopsis thaliana] (TAIR:AT3G15270.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO69773.1); contains InterPro domain Squamosa promoter-binding protein (InterPro:IPR017238); contains InterPro domain Transcription factor, SBP-box; (InterPro:IPR004333)
Range:  from: 19810089    to: 19810969    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version