AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
     <---------ANAC58                              --------->YAB1
     <---------ANAC58                            --------->ARR11(3)
     <---------ANAC46                            <---------ARR11(3)                           ------
<---------MYB52(1)                              --------->GLK1(1)                             ------
----------DOF2                       ----------->RAV1(1)                                    --------
-->YAB5                             <----------ID1<------ZmHOX2a(2)            --------->TOE2(3)   <
--YAB5                ===================================HOX2a_HOX2a       --------->KAN1 --------->YAB1
-TOE2(3)              <------ZmHOX2a(1)   --------->MYB52(1)          ----------->GT1  ---------->DOF2
 
tcctttaggcttgtactgaagattaggaggctacaaaaaacaacaaaacagagatcataagaagaagagaatgaagttaaattcttaaaacaaagataag  16791400
                                                    ------>ZmHOX2a(2)
                                                  --------->GATA12
      ================================================bZIP_DOF
      ---------->DOF2                             <---------GATA12       <---------WOX13(2)
--------->YAB1      <---------ZAT14         <---------O2  --------->HSFB2a(2)
--------->YAB5      --------->ZAT14         ===================================================bZIP_DOF
--->ANAC58      <---------ALFIN1            --------->TGA1a <---------MYB52(1)
--->ANAC58      --------->AtMYB61           <---------TGA1a--------->LBD16          <----------DOF2
->CCA1(2)      <---------MYB55(2)           --------->O2 <---------LBD16 --------->WOX13(2)
---------ATHB12--------->MYB46(3)      ------->TEIL<------ZmHOX2a(2)--------->RVE1(2)             --
 
aaatcataccaaagtgcaaccactgcaaggagcatcacattgaacccaagtgagatcgcttccggtatcaatatcaaattgaaatgcctttggagggctt  16791500
                                                           <---------AHL20(3)
                     --------->ARR11(2)            --------->DOF5.7(1)
                     --------->RVE1(2)    ----------->GT1  <---------AHL20(2)
         <---------YAB1                   <---------------AtSPL8
         <---------TOE2(3)           <------ZmHOX2a(1)--------->ICU4
    <---------AtLEC2 <---------ARR14(2)  --------->DAG2   --------->AHL12(1)               ---------
---->ZmHOX2a(1)      --------->ARR14(2) ---------->DOF2   <---------AHL12(1)              --------->CCA1(2)
 
cctatttgcattaagactgagtagtatctacagaaacagaggaaaaagttacaaaaaatgatttttttggtttgtttttgtattatcaacaagatagaga  16791600
                                                                           <---------TOE2(3)     <--
                                                                  --------->ARR14(2)         -------
               --------->ANAC46                                   <---------ARR14(2)         <------
             <-----------------AGL1                               <---------GATA12           <------
             ----------------->AGL1<------NtERF2                  --------->GATA12           <------
            -------->P            --------->LBD16                 <---------ARR11(2)         <------
           --------->KAN1        --------->ETT(1)                <------ZmHOX2a(1)           -------
         <---------ANAC58        <---------ANAC46           <------ZmHOX2a(1)       <---------YAB1 <
    <---------RVE1(2)           <---------LBD16         <------ZmHOX2a(1)  <---------TOE1(3) <------
-->GT1   <---------ANAC58    --------->DOF5.7(2)      <---------TOE2(3) <---------REM1(1)    <------
 
aaacattgatgtgcttacccgagagggaagacgttgccggagagagggaagacgactgaggaaggagaggatttgatgaaggttttgaagattgaagatt  16791700
                                                                          --------->ANAC58
                                                                          --------->ANAC46
     <------ZmHOX2a(1)                                                    --------->ANAC58
-------YAB1                                                             <---------AtLEC2
-->ARR11(3)                              --------->ARR14(3)         <---------ANAC58
---ARR11(3)                              --------->ARR11(3)         <---------ANAC46
---ARR14(2)                              <---------ARR14(2)         <---------ANAC58
---GLK1(2)                               --------->GLK1(2)         --------->MYB52(2)
---ARR14(3)                              <---------ARR11(3)  <----------DOF2          ---------->DOF2
-->ARR14(3)                              <---------GATA12 --------->ARR11(3)         --------->AHL20(2)
---------RVE1(2)                         <---------ARR14(3) ------>ZmHOX2a(2)   ------------>CBF
---GATA12                           ----------->GT1       <---------ARR11(3)   --------->ANAC58
---RVE1(2)            ------------------------>ANAC81     <---------RVE1(2)    --------->ANAC58  ---
 
ttgatagaggaactatgaccaagaacaagaacagaagaagagaaaatcttgatatcatcttgatctttgttacttgcacgacaaacaataaaagaattca  16791800
                       <---------YAB1
                      --------->AHL20(3)
                      <---------AHL20(3)
                     --------->YAB1
                  --------->YAB5
                 <---------YAB1
                ------>ZmHOX2a(2)
               <---------At4g35610
               --------->CCA1(2)
               <------ZmHOX2a(2)
              <---------AGP1
              --------->ARR11(3)
              --------->AGP1--------->CCA1(2)
              <---------GATA12             ------------>CBF
              --------->GATA12            --------->RVE1(2)
              <---------RVE1(2)         <---------AHL20(1)
              <---------ARR14(2)        <---------ARR11(3)                 <---------ARR14(2)
              <---------ARR11(3)        --------->AHL20(1)            --------->DOF5.7(1)      <----
              --------->ARR14(2) ----------->GT1                    --------->DOF5.7(1)   --------->KAN1
             <---------GLK1(1)--------->CCA1(2)                     ---------->DOF2      <---------AHL25(1)
  --------->CCA1(2) <---------YAB1 ------------>CBF          ----------->GT1             <---------AHL25(3)
------->DOF2----------->ARR10<---------RVE1(2)  --------->YAB1 ----------->GT1           --------->AHL20(2)
 
caaagagatgaagatgagatctgattataagagatagggtcaatatatcaatggtcatatagtaacgagaaaaaagagaatacagtaagacattaattct  16791900
                                     <---------AHL25(2)
                                     <---------AHL20(2)
                                     --------->AHL12(3)
                            --------->KAN1
                           --------->AHL20(3)
                           <---------AHL20(3)
                           <---------AHL20(2)
                           --------->AHL20(1)
                           <---------AHL20(1)
                           --------->AHL20(2)
                           --------->AHL25(1)
                           <---------AHL25(1)
                           --------->ARR11(3)
                           <---------ARR11(3)     <---------AHL20(3)
                           <---------AHL12(1)     --------->AHL20(2)                               <
                           --------->AHL25(2)     --------->AHL20(3)                            ----
                           <---------AHL25(2)     --------->AHL12(3)                           -----
                           --------->AHL25(3)     <---------AHL12(3)                           -----
                      ------------>CBF      ----------->GT1                                   ------
             <---------AHL12(3)      <---------AHL12(3)                                      <------
             --------->AHL20(3)      <---------AHL20(3)             ---------->DOF2--------->KAN1 <-
    <---------YAB1  ----------->GT1  <---------AHL25(1)    ------------>CBF   --------->YAB1--------
------DOF2   <---------AHL20(3)      --------->AHL20(3)  ----------->GT1 ------------>CBF   <-------
 
ttgtgttttcatagaaaaatatagggtcaatatattctatttttttttggtaaaaatatagggtcaatatagaaagttcaatggtcatattctaatatca  16792000
                                                                                                ----
                                                                                                <---
                                                                                                ----
                                                                                                <---
                                                                                                ----
                                                                                                <---
                                                                                              <-----
                                                                                             -------
                                                                                             <------
                                                                                             <------
                                                                                             -------
                                                                                             <------
                                                                                            --------
                                                                                           <--------
                                                                                           ---------
                                                                                          --------->AHL12(2)
                                                                                          --------->AHL20(3)
                                                                                        <---------YAB1
                                                                                        --------->AHL20(3)
       ---------->DOF2                                        ---------->DOF2           <---------AHL20(2)
  ----------->GT1                                        <---------YAB1                 --------->AHL20(2)
 --------->TOE1(3)                                       ----------->TBP                <---------AHL20(3)
<---------ANAC46                                      <---------AHL20(2)                --------->AHL25(3)
----------->GT1                                     <---------AHL12(2)              --------->AHL25(1)
---------TOE2(3)                                    --------->AHL12(2)              <---------AHL20(2)
----->DOF5.7(2)                                    --------->AHL12(1)               --------->AHL12(3)
---->TOE2(3)                                       --------->AHL25(2)               --------->AHL20(2)
---->WOX13(2)                                      <---------AHL12(1)               <---------AHL25(1)
--->YAB5 --------->DOF5.7(1) --------->KAN1       <---------CCA1(1)                 <---------AHL12(3)
---YAB1--------->DOF5.7(1)  <---------AHL25(1)    <---------RVE1(1)       --------->ZAT18 <---------AHL20(3)
--------DOF5.7(2)           <---------AHL25(3)   <---------ARR11(3)       <---------ZAT18 --------->AHL25(2)
->ARR11(3)                  --------->AHL20(2)   --------->ARR11(3)       --------->ZAT14 --------->AHL12(3)
--ARR11(3)    <---------ARR14(2)  <----------DOF2<---------RVE1(2)        <---------ZAT14 <---------AHL25(2)
 
ttaacgtgaaaaaagagaatacagtaagacattaattctttgtgttttaagagatattttataaataaagaattaagtgcagactatttatattattatt  16792100
                              --------------->AGL15
                             <---------ANAC58
                             <---------ANAC46
   <---------AHL12(2)        <---------ANAC58
  <---------AHL12(2)       <---------YAB1
  --------->AHL12(2)   --------->AHL20(1)
  <---------AHL12(1)   <---------AHL20(3)
  --------->AHL12(1)   <---------AHL12(2)
  --------->AHL12(3)   <---------AHL20(2)
  <---------AHL20(2)   --------->AHL20(3)
  <---------AHL12(3)   --------->AHL25(2)
 <---------AHL12(1)    <---------AHL25(3)
 <---------AHL20(3)    <---------AHL25(2)
 <---------AHL20(2)   <---------AHL20(2)
 --------->AHL20(2)   --------->AHL12(3)
 --------->AHL20(1)   --------->ATHB51
 <---------AHL20(1)   <---------ICU4
 --------->AHL12(1)   --------->AHL12(1)
 --------->ARR11(3)   <---------AHL12(3)
 <---------AHL25(2)   <---------AHL12(1)
 <---------ARR11(3)   --------->AHL20(2)
 --------->AHL25(3)   --------->AHL25(3)
 --------->AHL25(2)   --------->AHL25(1)
 <---------AHL25(3)   <---------AHL25(3)
 --------->AHL25(1)   <---------AHL25(2)
 <---------AHL25(1)   <---------AHL25(1)
 --------->AHL20(3)  <---------YAB1
----->AHL20(2)       <---------YAB5
------AHL20(2)       --------->ICU4
----->AHL20(3)       --------->AHL25(3)
------AHL20(3)      <---------AHL20(3)                                                 --------->YAB5
----->AHL25(1)      --------->AHL12(2)                                                 --------->YAB1
------AHL25(1)      --------->AHL20(3)         <---------ICU4                          <---------ICU4
----YAB1            <---------AHL12(2)         --------->YAB5                         <---------YAB1
-->AHL20(3)         <---------AHL25(2)         <---------AHL25(3)                     --------->ICU4
---AHL20(2)         --------->AHL12(3)        --------->AHL25(3)                    --------->YAB1 -
---AHL20(3)        <---------ICU4             --------->AHL20(2)                   --------->ICU4  -
-->AHL25(2)        --------->YAB5             <---------KAN1             <---------GLK1(1)         -
---AHL25(2)        --------->YAB1         <---------------------WRI1    <---------RVE1(2)    <------
->AHL12(1)        <---------AHL20(2)<---------HSFB2a(2)        <---------ANAC46   --------->AHL20(3)
-YAB1             <---------YAB1--------->ATHB12             ----------->GT1      <---------AHL20(3)
>AHL25(3)       --------->YAB1<---------------AGL15  ---------->DOF2  <---------YAB1<---------ICU4 -
 
ttaatatattttctcccatttataattattttgcttgtttgggaagagaataaatacaaagaaatggtgtattttgatttcccaaaattatgatgacttt  16792200
                          --------->At4g35610
                  --------->YAB1
                  <---------ICU4
                 --------->ICU4
              --------->AHL25(2)
              <---------AHL12(3)
              <---------AHL20(2)
              --------->AHL20(1)
              <---------AHL25(3)
              --------->AHL20(2)
              --------->AHL20(3)
              <---------AHL25(2)
              <---------AHL25(1)
              --------->AHL25(1)
              <---------AHL20(3)
             <---------AHL20(2)
             <---------AHL12(3)                    --------->AHL12(1)
             --------->AHL12(3)                    <---------AHL25(1)
             --------->AHL25(1)                    <---------AHL12(3)
             --------->AHL20(2)                    <---------AHL12(1)
             <---------AHL25(3)                    <---------AHL25(3)
             <---------AHL25(1)                   --------->AHL20(1)
             --------->AHL12(1)                   <---------AHL20(1)
             <---------AHL12(1)                   --------->AHL20(3)
             --------->AHL25(3)                   --------->AHL25(3)
             --------->AHL25(2)                   <---------ARR11(3)
             <---------AHL25(2)                   --------->AHL25(2)
           --------->WOX13(2)                     <---------AHL20(3)
           <---------WOX13(2)                     --------->ARR11(3)
           <---------AHL12(2)                     <---------AHL25(2)
      ----------->GT1     <---------At4g35610     --------->AHL12(1)
    --------->At4g35610<---------At4g35610        <---------AHL12(1)
   --------->ANAC58    --------->At4g35610<---------ANAC46
   --------->ANAC58 <---------YAB1       <-------TEIL
-------->ANAC58 <---------WOX13(2)    --------->HSFC1(2)
-------->AtLEC2 --------->WOX13(2)    <---------HSFC1(2)                                --------->DOF5.7(1)
-------->ANAC58<---------AHL12(2)     --------->HSFB2a(1)                           <-------GAMYB
----DOF2   --------->AHL12(2)         <---------HSFB2a(1)   <------ZmHOX2a(1)       --------->At5g28300
-------->ANAC46--------->AHL12(2)>>>>>>>>>TBF1    --------->AHL12(2)           <---------RVE1(2)
 
ccaagcaagcagaaaattaaattatgagcagatgaagaagaagcttcgtagaaaatatttggaggacttccaacgcgttttagacacggttaagggctga  16792300
<- Previous    Next ->

AGI:  At1g44130.1   
Description:  nucellin protein, putative. similar to nucellin protein, putative [Arabidopsis thaliana] (TAIR:AT1G77480.2); similar to unnamed protein product [Vitis vinifera] (GB:CAO61887.1); contains InterPro domain Peptidase aspartic, catalytic; (InterPro:IPR009007); contains InterPro domain Peptidase A1; (InterPro:IPR001461)
Range:  from: 16789948    to: 16791758    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version