AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                        <---------AHL25(1)
                                                                        --------->AHL20(2)
                                                                        <---------AHL20(2)
                                                                        <---------AHL25(2)
                                                                        --------->AHL25(2)
                                                                        --------->AHL12(1)
                                                                        <---------AHL12(1)
                                                                        --------->AHL20(1)
                                                                        <---------AHL25(3)
                                                                       <---------AHL25(2)
                                                                       --------->AHL12(1)
                                                                       <---------AHL12(1)
                                                                       --------->AHL12(3)
                                                                       --------->AHL25(3)
                                                                       <---------AHL12(3)
                                                                      <---------AHL12(2)
 --------->RVE1(2)                                                    --------->AHL12(2)        ----
------->AtMYB61                                                    --------->AHL20(2)           <---
----->GAMYB                       <-----------GT1        <---------AHL25(3)                    -----
------>MYB46(3)  ----------->RAV1(1) <---------YAB5      --------->AHL20(2)                 --------
-ANAC58         <---------KAN1 <---------KAN1<---------ATHB12    ----------->GT1           <--------
-ANAC58 <-----------GT1  ---------->DOF2    --------->RVE1(2)  ---------->DOF2           <---------CCA1(2)
 
accatctctatttacaagaacaacacaataaagcatattactcatcaaatcaactccaaataaaacaaaagtaaattttttgaatttgacttatatcata  12745200
                                                                                            --------
                                                                                           <--------
                                                                                           ---------
                                                                                    -------->HAHB4
                                                                                    <---------ICU4
                                                                                   <---------YAB1
                                                                                  <---------AHL20(3)
                                                                                  --------->AHL25(2)
                                                                                  --------->AHL20(3)
                                                                                  <---------AHL12(2)
                           ------>MYB46(1)                                        --------->AHL12(2)
                           ------>MYB83                                          <---------AHL25(3)
                         <---------MYB59                                         --------->YAB1
                         <---------MYB46(2)                               <---------ANAC46 <--------
              --------->AHL20(3)                                          ----------->GT1 <---------KAN4(2)
              --------->AHL20(2)              <---------ARR11(3)<---------DOF5.7(1)--------->ICU4
    --------->MYB46(3)<-----------GT1       --------->ANAC58    <----------DOF2 --------->AHL12(1)
----->DAG2    --------->AHL25(1)            --------->ANAC58   <---------DOF5.7(1)<---------AHL25(2)
------------AtSPL8  --------->WOX13(2)  --------->RVE1(2)      --------->TOE2(3)<---------AHL20(2)
----->DOF2    <---------AHL20(2)   <---------ANAC46         <-----------GT1     <---------AHL12(1)
->YAB1        <---------AHL20(3)   ----------->GT1         <-----------GT1--------->ANAC55(2)
-YAB1        <---------DOF5.7(1)  <---------TOE2(3)<-----------GT1        <---------ANAC55(2)
 
aagtacaacaatcccatttttttagttaccaaactatgaggtatatcaagaaatttacattttaaacctttttcatcgcgtaaataataatcgaataatc  12745300
      --------->ANAC58
      --------->ANAC55(2)
      --------->ANAC58                                                     --------->ANAC55(2)
      --------->ANAC46                                                     <---------ANAC58
    <-----------GT1                         --------->YAB1                 <---------ANAC58
 <----------DOF2 ---------->DOF2           <---------ATHB12              <---------AHL20(2)        <
->KAN4(2)  ----------->GT1           --------->GLK1(2)                   <-----------GT1   <--------
-KAN4(1)  --------->ANAC58         --------->KAN1                     --------->WOX13(2)   <--------
>KAN4(1)  --------->ANAC58        <---------RVE1(2)                <----------DOF2       <----------
-KAN1 <---------ANAC55(2)         <---------YAB5 ---------->DOF2  <---------DOF5.7(1) --------->ANAC46
 
tccgattttacgcaaggaaacaaagaaaaactatatagagattccaataatccaaagtcgttcacaaactctttatttacttgatttctaagtaaccatt  12745400
                                           --------->MYB52(1)
                                         ------>ZmHOX2a(2)
                                        <------ZmHOX2a(2)
                                       --------->ARR11(2)
                                       <---------GATA12
                                       --------->AGP1
                                       <---------AGP1
                                       <---------ARR11(2)
                                       --------->RVE1(2)
                                       --------->GATA12
                                       --------->ARR11(3)
                                       <---------ARR14(2)
                                       <---------ARR11(3)
                                  =============HOX2a_HOX2a
<---------At5g28300               ==============HOX2a_HOX2a
-----------GT1                    <------ZmHOX2a(1)                                       <---------
-YAB5                         ---------->DOF2                                             <---------
----MYB.PH3(1)              <---------YAB1----------->HVH21                       ---------->DOF2
-GT1                  ---------->DOF2  --------->ARR14(2)                     --------->YAB1       <
 
ttttacagtcaatacattttcagacaaaagtatgaaaggacagatctaacagagttttaagagattacttagaaatttcaaacataaaagaaacaagtac  12745500
                             <---------ANAC58
                        <---------At4g35610
                        <---------ZAT2
                 <---------CCA1(2)
                --------->ARR14(2)
                ------->TEIL <---------ANAC58
                <---------ARR11(2)
                --------->ARR11(2)
                --------->RVE1(2)                       <---------ANAC58
                <---------ARR11(1)                      <---------ANAC58                     <------
       <-----------GT1  --------->At4g35610      <---------ZAT18                      <----------DOF2
<----------DOF2 <---------ARR14(2)               --------->ZAT14                     <---------DOF5.7(1)
------AtSPL3   <---------ARR14(1)                <-------TEIL                  <---------GLK1(2)
------AtSPL8   <---------CCA1(2)<-------GAMYB    <---------ZAT14               <---------ANAC58
---------DOF5.7(1)      --------->ZAT2           --------->ZAT18               <---------ANAC58
 
ggtcttttgtttaccatcgtatctctcagcttgctcgttgagtttcgccaagtacacttgcttcgctctctcgttctccatagcttctcctttctctctt  12745600
                                                                  <------MYB46(1)
                                                                  <------MYB83
                                                                 --------->MYB59
                                                                 <---------AtMYB61
                                                               <---------MYB52(1)
                                                              <-------GAMYB                 --------
                                             ----------->TBP <---------MYB46(3)           --------->MYB52(1)
                                        --------->ANAC58     <---------DEAR3(2)         <---------ATHB12
                                        --------->ANAC58    <---------DEAR3(1)         --------->RVE1(2)
                                    <-----------HVH21       <---------RAP2.6(2)   --------->ANAC58
                         *TSS    --------->At4g35610        <---------ANAC46  <------ZmHOX2a(1)
 --------->HSFB2a(2) <---------YAB1--------->bZIP60(1)<---------KAN1       <-----------RAV1(2)------
---DOF5.7(1) <----------DOF2     --------->ZAT14---------->DOF2<---------ARR11(2) --------->ANAC58
 
ctctctcgaattgagacttttgttctgatcaaaaactgctgtcacgatataaaaagaattttggcggtttggtttaagacaggagaagcaaatcaacggc  12745700
                                                                          <---------ANAC58
                                                                        <------MYB83
                                                            <---------RVE1(2)    <---------ALFIN1
                                                            <---------GATA12 <---------ZAT18
                                              --------->RVE1(2)         <------MYB46(1)
                                              --------->GLK1(2)         <---------ANAC58
                                              <-----------ARR10         <---------ANAC58
                                              <---------GATA12          <---------ANAC46
                                              ------->TEIL  --------->GATA12 --------->ZAT18
                                             <---------GLK1(2)         <---------AtMYB61
                                             <---------ARR14(1)        --------->MYB46(2)
                                   --------->YAB1       <---------MYB52(1)<---------ANAC58
                                  <---------ZAT6     --------->MYB46(3)--------->MYB111(1)         -
->MYB46(3)        <---------ZAT14 <---------YAB5--------->RVE1(2)      <---------MYB46(3)         <-
--->At4g35610<---------RVE1(2)  ----------->GT1<---------KAN1     <---------RVE1(2)      <----------DOF2
 
tgagattaagtctctagatagtggagagcctcaaatagtgataacaacgaatctcaaccgttggatttagatgtttggtgtgccccatgcttctttgttt  12745800
                                                                                      <----------DOF2
                                                                                   <---------ALFIN1
                                                       <---------MYB59           <---------ALFIN1
                                                --------->At4g35610             --------->MYB46(3)
            --------->YAB1                      <---------At4g35610           --------->ARR11(2)
            <---------ICU4                  ------>ZmHOX2a(2)           --------->DOF5.7(1)
           <---------YAB1                  <------ZmHOX2a(2)--------->AHL25(1)<---------ARR14(2)
           --------->ICU4                 <---------ARR11(2)-------->ATHB1 --------->ANAC58
          --------->AHL25(2)              <---------ARR14(2)--------->AHL12(1)--------->ARR14(2)
          <---------AHL25(2)              --------->ARR11(2)--------->KAN1 --------->ANAC58
          <---------AHL20(3)              <---------GATA12 <---------YAB5  --------->ANAC46
          --------->AHL20(3)              --------->GATA12 <---------KAN1--------->MYB52(1)
         --------->YAB1            <---------KAN1------>ZmHOX2a(2)  ----------------->AGL2
        <---------YAB1            --------->ARR11(2) ------->TEIL   ----------------->AG
   <---------MYB46(3)           --------->LBD16<---------RVE1(2)    ----------------->AGL1
   ----------->GT1       <-------TEIL     --------->ARR14(2)<---------AHL12(1)<---------ARR11(2)
-------->ATHB12--------->YAB5   ----------->GT1--------->GATA12     <-----------------AGL3
--------YAB1--------->YAB5    <---------LBD16  <---------GATA12     ----------------->AGL3  <-------
 
tttcattggttataataataactaggggttcaatccggataaaccgatctgatctgaaccgaattattcaatccaaaaacggaaccacactttcaatgaa  12745900
                        --------->TOE2(3)
                        --------->TOE1(3)
                        <---------DAG2
                  --------------->AtSPL8
                 <----------DOF2
             <-----------GT1
          <---------AHL25(2)
          <---------AHL20(3)
          --------->AHL20(3)
          --------->AHL12(2)
          <---------AHL12(2)
        --------->AHL20(2)
        <---------AHL20(2)
        --------->AHL12(1)
        --------->AHL12(3)
        <---------AHL12(1)
        --------->AHL25(1)
        <---------YAB1------->TEIL
        <---------AHL12(3)                           --------->RVE1(2)
        <---------AHL25(3)            --------->AHL25(1)                                   -------->HAHB4
        --------->AHL25(3)            <---------AHL20(2)                                   <--------
       --------->AHL20(2)             <---------AHL25(2)                                  --------->ICU4
       --------->AHL20(1)             <---------AHL12(3)          ----------->GT1         <---------YAB5
       <---------AHL20(2)             --------->AHL12(2)          <-------GAMYB          <---------WOX13(2)
       <---------AHL20(1)            <---------AHL12(1)          ----------->GT1       --------->AHL20(2)
       --------->AHL25(3)         --------->YAB5   <---------AHL12(1)                  <---------AHL25(1)
       --------->AHL20(3)         <--------ATHB1   --------->AHL12(1)               --------->YAB5
       <---------AHL25(2)         --------->YAB1  --------->AHL20(2)               --------->ICU4<--
       --------->AHL25(2)        <---------ATHB12 --------->AHL25(2)              <---------TOE2(3)
       <---------AHL20(3)        <---------YAB5   <---------AHL25(1)           <---------YAB1<------
       <---------AHL25(1)        <---------YAB1   --------->AHL12(3)      ----------->GT1--------->WOX13(2)
      --------->YAB1 <-----------GT1 --------->AHL12(1)    <---------KAN1--------->DAG2--------->AHL25(1)
--ATHB12<---------AHL25(1)       --------->ICU4   <---------AHL12(2)    ---------->DOF2<---------AHL20(2)
 
ttgtttttaatataattttcctttgtaccttatacaatgattttttttaaaaaaaaaatcacatatgtctgttaaaaaagttattaatgtttaattatgc  12746000
                                           --------->AHL20(1)
                                           --------->ARR11(3)
                                           <---------ARR11(3)
                                           --------->AHL12(1)
                                           <---------AHL25(2)
                                           <---------AHL12(1)
                                           <---------AHL20(1)
                                           --------->AHL20(3)
                                           <---------AHL20(3)
                                           --------->AHL25(2)
                                           <---------AHL25(3)
                                          --------->AHL25(1)
                                          <---------AHL12(3)
                                          --------->AHL12(3)
                                          <---------AHL20(2)
                                          <---------AHL25(1)
                                          <---------AHL12(1)
                                          --------->AHL12(1)
                                          --------->AHL25(3)
                                         --------->AHL25(3)                                 ------->TEIL
           --------->ZAT6               --------->AHL12(2)                               <---------YAB5
          --------->ZAT14             <---------AHL12(3)                                 <---------YAB1
   <---------AHL25(2)                 --------->AHL12(3)                               --------->YAB1
   --------->AHL20(3)                 --------->AHL20(2)                               -------->HAHB4
   --------->AHL25(2)                 <---------AHL20(2)                               <---------ICU4
   <---------AHL20(2)                 --------->AHL20(3)                              --------->ICU4
   <---------AHL20(3)                 <---------AHL25(1)                             --------->AHL20(3)
 <---------AHL25(1)                   <---------AHL20(3)                             --------->AHL25(2)
 --------->AHL20(3)               <---------AHL12(1)                                 <---------AHL12(2)
 <---------AHL20(2)               --------->ICU4        <---------AHL25(2)           <---------AHL25(2)
 <---------AHL12(3)              <---------AHL20(3)     <---------AHL25(1)           <---------AHL20(3)
 <---------AHL25(2)              <---------AHL25(2)     --------->AHL20(3)          --------->YAB1
 --------->AHL12(3)              --------->AHL25(2)     <---------AHL20(2)         <---------AHL12(1)
 --------->AHL25(3)              --------->AHL20(3)     --------->AHL12(3)        <---------AHL25(2)
 <---------AHL20(3)              <---------AHL20(1)     <---------AHL12(3)        --------->AHL25(2)
<---------AHL12(2)               --------->AHL12(2)   --------->AHL12(2)          <---------AHL20(3)
--------->AHL12(2)              --------->YAB1  <-----------GT1      <-----------GT1<---------AHL25(3)
-ICU4 <-----------GT1 <-----------GT1 --------->AHL25(1)<---------AHL20(3)        --------->AHL20(2)
-------CCA1(2)        --------->YAB1<---------AHL12(2)--------->AHL12(3)          --------->AHL20(3)
---YAB1   <---------ZAT14    --------->YAB1<---------AHL12(2)      <---------KAN1--------->YAB1    -
 
atatattattttctacactaactaataacaattcataatatttaaatattttcacatatttttttttggaatttacaatttctaaaataataatgaatgc  12746100
<- Previous    Next ->

AGI:  At1g34760.1   
Description:  GRF11 (General regulatory factor 11); amino acid binding / protein phosphorylated amino acid binding. Identical to 14-3-3-like protein GF14 omicron (GRF11) [Arabidopsis Thaliana] (GB:Q9S9Z8); similar to GRF10 (GENERAL REGULATORY FACTOR 10), protein phosphorylated amino acid binding [Arabidopsis thaliana] (TAIR:AT1G22300.2); similar to 14-3-3-like protein [Gossypium hirsutum] (GB:ABD63905.1); contains InterPro domain 14-3-3 protein; (InterPro:IPR000308)
Range:  from: 12743826    to: 12745626    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version