AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                --------->At4g35610
                ----------->RAV1(2)                                   --------->YAB1
                <---------At4g35610                              <---------YAB1                   <-
               --------->GLK1(2)                ------->TEIL --------->ARR11(3)                   <-
            --------->ANAC58         <---------ANAC46        --------->ARR14(2)              <------
            --------->ANAC58         <---------ANAC58        <---------ARR11(3)              <------
       <----------ID1          --------->ARR11(3)           <------ZmHOX2a(1)                <------
     --------->ANAC58          <---------ARR11(3)       --------->ZAT14              --------->YAB1
     --------->ANAC46         <---------GLK1(1)<-----------GT1<------ZmHOX2a(2)   <----------DOF2 <-
     --------->ANAC58------->TEIL    <---------ANAC58   <---------ZAT14     --------->YAB5   -------
 
tcgtccaaacgcgacaagcatctgaacctttggagttcttccttgtttatgaaccctactgcaggatcatcaataacaacaattcctttcacaatctcgt  7260400
                           --------->GATA12
                           --------->ARR14(2)     <---------At4g35610
           <---------DOF5.7(1)     ----------->GT1--------->At4g35610                <---------GLK1(1)
           <----------DOF2 <---------ARR14(2)   --------->ZAT18                      --------->KAN1
        <---------ARR11(3) <---------GLK1(2) <---------ANAC46                        --------->GLK1(1)
  --------->LBD16          <---------ARR11(2)<---------ANAC55(2)                    --------->ARR14(2)
 <---------LBD16   --------->LBD16--------->HSFB2a(2)                               <---------ARR14(2)
<---------LBD16    <---------MYB46(3)        <---------ANAC58                       <---------RVE1(2)
--------ANAC46    <---------ANAC46<---------HSFB2a(2) <---------TOE2(3)             --------->ARR11(3)
--------ANAC58   <---------LBD16 <---------LBD16--------->ZAT14                     <---------ARR11(3)
---ANAC58 <---------DAG2   --------->ARR11(1)<---------ANAC58                    <--------P
---ANAC58 <---------DOF5.7(1)<-------TEIL--------->KAN1 <------ZmHOX2a(1)>>>>>>>>>>>>>>>>>LFY
---O2   --------->ARR11(3)--------->KAN1--------->DOF5.7(1)             --------->ARR11(2)
--------ANAC58  <-----------RAV1(1)<------NtERF2<---------ZAT14         <---------ARR11(2)        <-
-->O2  <---------KAN1    ----------->ARR10  <-----------------------TaNAC69(2)<---------ATHB12   ---
 
ggctcggggaataccttttctgcgggtgaagattcgtcgggaaaaaatgcgtgaactgaggaaactttccacttggttccaatggtagatatcccttgag  7260500
                                                                                                  --
        --------->YAB1                             <-------TEIL                                   <-
        <---------ICU4                     <---------ARR14(2)                                    ---
       <---------ATHB12                    <---------ARR11(2)                                    ---
   <---------AHL25(1)                      --------->ARR14(2)                                    <--
   --------->AHL25(1)                    <----------DOF2                  <---------ANAC46       <--
   --------->AHL20(3)                   <---------ANAC46                 --------->ZAT2          ---
   <---------AHL20(2)                   <---------ANAC58                 <---------At4g35610     ---
   --------->AHL20(2)                   <---------ANAC58                 <---------ZAT2          ---
   --------->AHL12(3)     <------ZmHOX2a(1)--------->ARR11(2)     <---------ARR11(3)             <--
------TEIL               --------->DOF5.7(1)   --------------->AtSPL8    --------->At4g35610     <--
------>CCA1(2)<---------HSFB2a(2)      ---------->ID1    <---------------AtSPL8              <------ZmHOX2a(1)
 
atacatataaatcatgtctggatgaagaaggaggctggacttggcgtttctgagtacattatagtacaagttctgtagctgggaaacagttagagaggaa  7260600
           ---------->DOF2
      <-------TEIL
------->CCA1(2)
-----ZmHOX2a(2)
------>RVE1(2)
------>ARR11(3)
-------ARR11(3)
-------ARR14(2)
------>ARR14(2)                                          --------->ARR11(3)
------>ARR11(2)         <------NtERF2        <---------HSFB2a(2)
------>GATA12         --------->ALFIN1       --------->HSFB2a(2)     --------->YAB1
-------GATA12      --------->DOF5.7(1)  <---------YAB5 ------->TEIL <---------YAB1           -------
-------ARR11(2)    --------->DAG2      --------->GLK1(2) <---------ARR11(3)         <------ZmHOX2a(1)
 
gatccaatgtgcatcaaagtgtaaggtggcaaacctctagctaatctttgagaagatgaacatcttgggttatcagaatagacatcaggacccaagtagt  7260700
                                                                          <---------ATHB12
                                                                         --------->WOX13(2)
                                                                        --------->WOX13(1)
                                                                      ------------>CBF
                                                                      <---------YAB1
                                                             --------->KAN1
                                                            <---------ARR11(3)
         <---------WOX13(2)                                 --------->RVE1(2)
         --------->WOX13(2)                                 <---------ARR14(2)
   --------->YAB5                                           --------->ARR14(2)
   <---------ICU4                        --------->ANAC46   --------->ARR11(3)
  --------->ICU4             --------->KAN1    <----------DOF2       --------->RVE1(2)       -------
  <---------YAB1 --------->ANAC58     --------->GLK1(2)     <---------ARR11(1)         <---------ANAC55(2)
-->MYB111(1)     --------->ANAC58    --------->KAN1        <---------CCA1(2) ------->TEIL  <--------
 
tgctcatgatgaaattaaccaagaaatactgatcactcgataatccgtcgctatacagactcatatcttcgatatcaatgaacctgcattacatatgaaa  7260800
                               --------->KAN4(2)
                              --------->HSFB2a(1)             --------->ANAC55(2)
                              <---------HSFB2a(1)             <---------ANAC55(1)      --------->YAB1
                              --------->KAN1                <---------AHL20(2)  <---------WOX13(2)
                            <------ZmHOX2a(1)             --------->WOX13(2)    --------->WOX13(2)
                         <---------ICU4                   <---------WOX13(2) ----------------->AG
                   --------->ANAC58                      <---------ICU4      ------------>CBF
    <------------CBF     --------->YAB1                 --------->ICU4       ----------------->AGL1
 ----------->RAV1(1)------------>CBF                <------ZmHOX2a(1)   --------->ARR14(2)      ----
--->DOF2           --------->ANAC58                --------->ANAC46     --------->GATA12     <------
-YAB1  <-----------HVH21--------->ICU4         <-----------GT1<---------ANAC55(2)     <---------YAB5
 
gtggcaacattgtcacaaatggaagcaataaggacattccaaaaacatagttacaggacataattaagtgtctcaaatttgccaatttagtcatagcatt  7260900
                                    <-----------GT1
        <--------HAHB4   ------>ZmHOX2a(2)
        <---------ICU4  <---------GLK1(1)
       <---------ATHB12 <<<<<<<<<GATA-2
<---------ARR14(2)      <<<<<<<<<GATA-3
--------->ARR14(2)      <<<<<<<<<GATA-1
--------->RVE1(2)       <------ZmHOX2a(2)                                            <---------YAB1
<---------ARR11(3)     --------->GATA12                                            <---------ICU4
--------->ARR11(3)     <---------GATA12                                            --------->YAB1
<-----------ARR10      <---------ARR11(3)                                          <--------HAHB4
--------->GLK1(2)      --------->RVE1(2)          <---------ICU4                   --------->YAB5
--------->GATA12       --------->ARR11(3)       ------------>CBF                  <---------YAB1
<---------GATA12       <---------AGP1    <----------DOF2<----------DOF2           <---------YAB5
----->YAB1            <---------CCA1(2)  <---------DOF5.7(1)                  <---------DAG2 <------ZmHOX2a(1)
------CBF <---------YAB1<<<<<<<<<GATA-4 <---------DOF5.7(1)                <-----------GT1 <--------
 
gaaaatctccatcattttagtccctagatctcttaagtttaacccttttctaacaatgactttagtctccataatgttttgccttatcattactaaggag  7261000
                --------->TOE2(3)
                --------->TOE1(3)
             <-----------GT1                --------->GATA12
           --------->AHL20(2)               <---------GATA12
           <---------AHL25(1)               --------->RVE1(2)
           --------->AHL25(1)               --------->GLK1(2)
           <---------AHL25(3)               --------->ARR11(3)                                 -----
         --------->WOX13(2)                 <---------ARR11(3)        <---------------AGL15---------
 --------->ARR11(3)                   ------->GAMYB                  <---------RVE1(2)   <----------
 <---------ARR11(3)                <-----------GT1        --------->DOF5.7(1)         ----------->GT1
-TOE2(3) <---------WOX13(2)     --------->WOX13(2)      ---------->DOF2           --------->YAB5
 
aaaacatcttcaaattaaaccctaaaaacttcacttattaacagcaaaatctacatttgaaaagactatgttgatattttgagaaagattagtaactctg  7261100
                                                                                         ---------->DOF2
                                                                                     --------->At4g35610
                                                        --------->RVE1(2)            <---------At4g35610
                                                       --------->RVE1(1)            --------->MYB59
                                               --------------------->WRI1        --------->STY1(2)
---->At4g35610                              <-----------GT1                 <-----------GT1
>ZAT6--------->KAN1                      <---------ICU4--------->CCA1(1)    --------->ZAT6         <
-GT1 <-----------GT1           <---------AHL12(2)--------->LBD16        <---------AHL12(1)      ----
 
cttcatatatactcttcacaatacaaaaaaaaaaaaaaaaccaatttttacccagaaaatatcgcaatccaacaatttttcactagttagctcaaagtca  7261200
                <---------TOE2(3)
          --------->GATA12                             <---------At5g28300
          --------->RVE1(2)                           <-----------GT1                 <---------ALFIN1
          <---------GATA12                        <---------DAG2                      --------->AtMYB61
      ------>ZmHOX2a(1)                           <---------------AGL15    --------------------->WRI1
     --------->TOE1(3)                            --------------->AGL15    <------------CBF  -------
     --------->TOE2(3)                         ---------->ID1        --------->PCF2--------->ANAC46
  <-----------GT1                              <-----------GT1       <------ZmHOX2a(2)----------->RAV1(1)
---------AHL12(2)----------->GT1            --------------->AtSPL8  <---------GATA12 --------->ANAC46
-------->CBF  ---------->DOF2         ------->TEIL<----------DOF2   --------->GATA12 --------->MYB46(3)
 
acaattttccttaaatctaaaggttactacgcttgaatacgaaccagtttgtactttttacagcaaaaatcgatcccacattgttcccaccacagaagat  7261300
<- Previous    Next ->

AGI:  At1g20870.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G54850.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO66281.1); contains InterPro domain HSP20-like chaperone (InterPro:IPR008978)
Range:  from: 7259091    to: 7260764    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version