AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                        ---------->ID1
                                <---------AHL25(2)
                                <---------AHL20(3)
                                --------->AHL20(3)
                                <---------AHL25(1)
                              <---------AHL25(2)
                              --------->AHL12(2)
                              <---------AHL12(2)
                              --------->AHL12(3)
                              --------->AHL25(2)
                              <---------AHL12(3)
                             --------->AHL12(1)
                             --------->AHL12(2)
                             <---------AHL12(1)
                             <---------AHL12(2)
                             <---------AHL20(1)
                             --------->ARR11(3)
                             <---------ARR11(3)
                             <---------AHL25(3)
                             --------->AHL20(1)
                             <---------AHL25(2)
                             --------->AHL25(2)
                            --------->AHL25(1)
                            <---------AHL25(1)
                            <---------AHL12(1)
                 --------->KAN1 <---------AHL20(2)
              --------->WOX13(2)--------->AHL12(3)
    --------->WOX13(2)      <---------AHL20(2)
    <---------WOX13(2)      <---------AHL12(3)                                   --------->AHL20(2)
   <---------AHL20(2)       --------->AHL12(3)                    --------->ARR11(3)
   <---------AHL25(1)       --------->AHL25(3)                    --------->RVE1(2)
   <---------AHL25(3)      --------->AHL25(3)                <---------RVE1(2)   <---------AHL20(2)
   <---------AHL20(3)      <---------AHL12(2)               --------->YAB1       <---------AHL25(3)
   --------->AHL20(3)      --------->AHL12(2)              <---------YAB1      --------->WOX13(2)
  --------->AHL20(2)      --------->AHL12(2)         <---------YAB5      --------->YAB5
  --------->AHL25(1)      --------->AHL12(3)       --------->YAB1--------->CCA1(1)
  --------->AHL25(3)      <---------AHL12(2)     --------->WOX13(2)   --------->At4g35610
  <---------AHL20(2)      <---------AHL12(3)    --------->YAB1   --------->RVE1(1)                 -
-------KAN1   <---------WOX13(2)<---------AHL12(3) <-----------GT1<---------ARR11(3)           <----
-----ANAC46  <-----------GT1--------->AHL12(1) <---------AHL20(2)<---------KAN1<---------WOX13(2)---
 
gtgtattaatttgatttaactaattcgataaatatttttttttggtgtttttaataaccattttgataatatctgatgacaaaattaaaaaaaacatttt  6948600
                                  <---------TOE2(3)
                               <---------YAB1
                            --------->ICU4
                            <---------YAB1
                           --------->AHL20(3)
                           <---------AHL12(2)                                        <---------AHL12(1)
                           <---------AHL20(3)                                        --------->AHL12(1)
                           --------->AHL12(3)                                      <---------AHL12(2)
                           --------->AHL25(2)                                     --------->AHL20(2)
                           --------->AHL12(2)                                     <---------AHL25(3)
                           <---------AHL25(2)                                    --------->AHL12(3)
                           <---------AHL12(3)                                    <---------AHL20(2)
                          --------->AHL12(1)                                     --------->AHL20(2)
                          -------->ATHB1                                         --------->AHL25(1)
                          --------->ATHB51                                       --------->AHL25(3)
                          -------->HAHB4                                         --------->AHL12(1)
                          --------->YAB1                                         <---------AHL12(3)
                          <---------AHL20(2)                                     <---------AHL25(1)
                          <---------AHL25(3)                                 <---------AHL12(3)
                          <--------HAHB4                                     --------->AHL20(2)
                          <---------ICU4                                  <---------WOX13(2)
                         <---------ATHB51                                 --------->WOX13(2)
                         <---------YAB1                                  --------->YAB5
                         <---------YAB5                                 <---------AHL12(1)
                        --------->WOX13(2)                              --------->AHL12(1)
                        <---------WOX13(2)                              --------->AHL12(3)
                        --------->AHL12(2)                              <---------AHL20(2)
                      --------->AHL12(3)                                --------->AHL25(1)
                      --------->AHL25(1)                                --------->AHL20(2)
                      <---------AHL12(1)                                <---------AHL12(3)
                      <---------AHL25(1)                                <---------AHL25(1)
                      --------->AHL25(3)                                <---------AHL25(3)
                      --------->AHL12(1)                                <---------YAB1 <---------ANAC55(2)
                      <---------AHL20(2)                                --------->AHL25(3)
                      --------->AHL20(2)                               --------->AHL25(1)
                      --------->AHL25(2)                  <---------AHL20(2) <---------AHL20(2)
                      <---------AHL12(3)                  <---------AHL25(3) --------->AHL20(3)
                      <---------AHL25(3)                 --------->AHL25(1)  --------->AHL25(2)
                     <---------AHL20(2)                  <---------AHL20(3)  <---------AHL20(3)
                     <---------AHL12(3)                  <---------AHL20(2)  <---------AHL25(3)
                     --------->AHL12(3)                  --------->AHL20(2)  <---------AHL25(1)
                     --------->AHL20(1)            --------->YAB1      <---------AHL20(3)
                     --------->AHL20(2)          <---------WOX13(2)    <---------AHL20(1)
                     <---------AHL20(1)        <---------AHL20(2)      --------->AHL20(3)
                     --------->AHL25(1)        --------->AHL20(2)      <---------AHL25(2)
                     <---------AHL25(1)      --------->ANAC58          --------->AHL25(2)
                     <---------AHL25(3)      --------->ANAC55(2)       --------->AHL20(1)
              <-----------GT1 --------->AHL12(2) --------->WOX13(2)    --------->AHL25(3)
       --------->AHL20(2)--------->AHL25(3)  --------->ANAC58 --------->YAB5 --------->AHL25(1)
     <----------DOF2 --------->AHL25(3)      ----------->GT1  --------->TOE2(3)  <---------AHL12(1)
<-----------GT1      <---------AHL25(2)      <---------ANAC55(2)       --------->AHL20(2)
-------->ARR11(2)    --------->AHL25(2)    <--------P    <---------AHL25(1) --------->AHL20(2)
-----YAB1  --------->YAB1--------->ICU4 <---------TOE2(3)--------->AHL25(3) <---------AHL20(2)
------>WOX13(2)     --------->AHL12(2)  <---------TOE1(3)<---------AHL25(3) --------->YAB1
 
catttacgctttaaatataacaaatttaattattattaatgttaaggtaagtaattagaattaaatgttaacaatataattaaaataaataagtaaacaa  6948700
                                     <---------YAB1
                                   <---------AHL25(3)
                                   <---------AHL20(2)
                                  <---------AHL12(1)
                                  --------->AHL25(2)
                                  --------->AHL12(1)
                                  <---------AHL25(2)
                                  <---------AHL25(1)
                                  --------->AHL25(3)
                                  <---------AHL25(3)
                                  --------->AHL20(1)
                                  --------->AHL20(3)
                                  <---------AHL20(1)
                                  <---------AHL20(2)
                                  --------->AHL20(2)
                                  --------->AHL25(1)
                                  <---------AHL20(3)
                                 <---------AHL12(2)
                                 --------->AHL12(2)
              <---------AHL20(2)<---------AHL12(2)
              <-----------GT1   --------->AHL12(2)
           --------->AHL12(2)  --------->AHL20(3)
           <---------AHL12(2)  <---------AHL25(1)
          <---------ICU4       --------->AHL25(2)
          -------->ATHB1       <---------AHL12(1)
          <--------HAHB4       --------->AHL12(1)                        <---------WOX13(2)
          --------->ATHB51     --------->AHL25(1)                        --------->WOX13(2)
          --------->YAB5       --------->AHL20(2)                       <-----------GT1 --------->ANAC58
         <---------KAN1        <---------AHL25(2)                      --------->AHL20(2)  ---------
         <---------YAB5        <---------AHL25(3)                   --------->WOX13(2)  --------->ANAC58
         <---------AHL12(1)    --------->ATHB51                     <---------WOX13(2) --------->DAG2
         --------->AHL25(3)    <---------AHL20(3)               --------->TOE2(3)     ---------->DOF2
         --------->ICU4       <---------KAN1                  --------->GLK1(2)--------->AHL20(1)
   --------->MYB52(1)         --------->AHL25(3)              --------->RVE1(2)--------->ARR11(3)
 <---------MYB52(2)           --------->AHL12(1)             --------->YAB1    <---------AHL20(2)
 --------->MYB46(3)           <---------AHL12(1)            <---------ATHB12   <---------AHL20(1) --
 
aataacaaacgaattattaacttgagagtcagaataatttattagtggagaacagatggaccaataatctaaatttaactaatatatagaaaagcaacat  6948800
                                                                                   <xxxxxxxxxxxxxxxxsmallRNA(le3)
                                                                                   <xxxxxxxxxxxxxxxxsmallRNA(si3)
                                                                                  <xxxxxxxxxxxxxxxsmallRNA(le3)
                                                                                  <xxxxxxxxxxxxxxxxxsmallRNA(si3)
                                                                                  <xxxxxxxxxxxxxxxsmallRNA(fl3)
                                                                                  <xxxxxxxxxxxxxxxsmallRNA(si3)
                                                                                  <xxxxxxxxxxxxxxxxx
                                                                                 <xxxxxxxxxxxxxxxxxx
                                                                                 <xxxxxxxxxxxxxxxxxx
                                                                                <xxxxxxxxxxxxxxxxxxx
                                                                                <---------ANAC46
                                                                                <---------TOE2(1)
                                                                      <---------ALFIN1      xxxxxxxx
                                                                      <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)
                                                                      --------->ANAC58    <---------ARR14(2)
                                                                      --------->ANAC46    --------->ARR14(2)
                                                                      --------->ANAC58  <xxxxxxxxxxx
       ------>ZmHOX2a(1)                                            <xxxxxxxxxxxxxxxxsmallRNA(i)
       ----------->HVH21                                            <xxxxxxxxxxxxxxxxsmallRNA(s)
 --------->KAN1                                                    <xxxxxxxxxxxxxxxxsmallRNA(s)
<---------AHL20(3)                                                 --------->TOE1(2) <xxxxxxxxxxxxxx
<---------AHL25(3)                                                --------->DEAR3(2)<------ZmHOX2a(1)
--------->AHL25(3)                                                <xxxxxxxxxxxxxxxsmallRNA(le3)
<---------AHL25(1)                                         <xxxxxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
<---------AHL25(2)                                        <---------ANAC46      <---------TOE1(1)
--------->AHL20(1)                                        <---------ANAC58  <---------DOF5.7(1)
--------->AHL25(2)                                        <---------ANAC58<xxxxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
<---------AHL20(1)                                        <xxxxxxxxxxxxxxxxsmallRNA(s)<xxxxxxxxxxxxx
<---------ARR11(3)                                     --------->ALFIN1------>NtERF2<xxxxxxxxxxxxxxx
--------->ARR11(3)                                 <xxxxxxxxxxxxxxxxsmallRNA(i) <xxxxxxxxxxxxxxxxxxx
--------->AHL20(2)                        --------->ARR11(3)      <xxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
--------->AHL20(3)       <---------AHL12(2)       <xxxxxxxxxxxxxxxxsmallRNA(i)  <xxxxxxxxxxxxxxxxxxx
--------->AHL25(1) <XXXXXXXXXXXXXXXXXXXXMIR426 <-----------HVH21 <xxxxxxxxxxxxxxxxxxxsmallRNA(se3)
<---------AHL20(2) --------->ZAT18        <---------ARR11(3)     ------->TEIL  <xxxxxxxxxxxxxxxxxxxx
-->RAV1(1)        --------->ALFIN1    ---------->DOF2<---------TGA1a<---------ALFIN1<xxxxxxxxxxxxxxx
----->TEIL      <---------ANAC46      =========================bZIP_DOF<xxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)
 
gaatatattcctgaccttggtgtggacaaattttccaaaaaaaaagataatgtcagaagtggggtttgaacccacgccctcttacgaggaccagaacttg  6948900
                                                                                                  <-
                                                                                                  <-
                                                                                                  --
                                                                                                  --
                                                                                                  --
                                                                                                  <-
                                                                                                  --
                                                                                                  --
                                                                                                  <-
                                   <---------YAB1                                                 <-
                 <xxxxxxxxxxxxxxxxsmallRNA(le3)                                                   <-
                 <xxxxxxxxxxxxxxxxsmallRNA(fl3)                                                 ----
                 <xxxxxxxxxxxxxxxxsmallRNA(s)                                                   <---
                <xxxxxxxxxxxxxxxxxsmallRNA(se3)                                                <----
                <xxxxxxxxxxxxxxxxsmallRNA(s)                                                   <----
               <xxxxxxxxxxxxxxxxxxsmallRNA(se3)                                                -----
               <xxxxxxxxxxxxxxxxxxsmallRNA(si3)                                                <----
               <xxxxxxxxxxxxxxxxsmallRNA(s)                                                    -----
              <xxxxxxxxxxxxxxxxxxxsmallRNA(si3)                                                <----
             <xxxxxxxxxxxxxxxxxxxxsmallRNA(si3)                                                -----
             --------->AtMYB61     ------>ZmHOX2a(1)                                           <----
            <---------ZAT18        ==================HOX2a_HOX2a                              ------
           <xxxxxxxxxxxxxxxxxxxsmallRNA(si3)                                                  <-----
           <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)                                               ------
     <xxxxxxxxxxxxxxxxxxsmallRNA(se3)       <---------ARR11(3)                                ------
     <------NtERF2                 =================HOX2a_HOX2a                               ------
     <xxxxxxxxxxxxxxxxxsmallRNA(fl3)        <---------GATA12                                  <-----
    ------>NtERF2<xxxxxxxxxxxxxxxxsmallRNA(i)                                                 ------
 <---------ATERF1(1)         <---------ANAC58 ------>ZmHOX2a(2)                               <-----
xxxxxxxsmallRNA(se3)         <---------bZIP60(2)                                              ------
xxxxxxxsmallRNA(si3)         --------->KAN1 --------->GATA12                                  ------
xxxxxxxsmallRNA(se3)      ------>ZmHOX2a(1) --------->RVE1(2)                                 <-----
xxxxxxxsmallRNA(se3)      ==========================HOX2a_HOX2a                               <-----
xxxxxxxxxxxxxxx>smallRNA(si3)<---------ANAC58<------ZmHOX2a(2)                                <-----
xxxxxsmallRNA(fl3)        ===========================HOX2a_HOX2a                              ------
xxxsmallRNA(fl3)<xxxxxxxxxxxxxxxxxsmallRNA(si3)                                              <------
xxxxsmallRNA(se3)<xxxxxxxxxxxxxxxxsmallRNA(si3)         --------->YAB1               <-----------HVH21
xxxxxxsmallRNA(se3)       ----------->TGA1  --------->ARR11(3)                      <---------ZAT6--
xxsmallRNA(l2)<xxxxxxxxxxxxxxxxxxxsmallRNA(se3)    --------->AHL20(2)        --------->ATHB12<------
xxxxxsmallRNA(le3)      ----------->RAV1(2) <---------AGP1<---------YAB5    <---------KAN1   -------
xxxxxsmallRNA(si3)      <---------ICU4     --------->RVE1(1)          --------->GLK1(2)      -------
xxxxxsmallRNA(se3) ------>NtERF2 *TSS   ---------->DOF2<-------TEIL  <---------ARR14(2)  -----------
 
agtctggcgccttagaccactcggccatcctgacgttcctgattaaagatctcataaattcatcatatagaagaatcggatgatttagtgtcaccaatta  6949000
       ------>MYB46(1)
     <---------MYB59
  <-----------GT1
--------->WOX13(2)
--------AHL20(2)
--------AHL25(3)
------->AHL25(2)
------->AHL20(1)
------->AHL20(2)
--------AHL25(1)
------->AHL20(3)
------->AHL25(3)
--------AHL25(2)
--------AHL20(3)
--------AHL20(1)
----->AHL12(2)
------AHL12(2)
-----AHL20(3)
-----AHL12(3)
---->AHL20(1)
-----AHL12(2)
---->AHL20(3)
-----AHL25(3)
---->AHL25(2)
-----AHL25(2)
--->ATHB51
---HAHB4                                                                         ------>ZmHOX2a(2)
-->ATHB1                                                                       --------->ARR14(2)
--->YAB1                                                                       <---------ARR14(2)
--->AHL25(1)                            --------->ARR14(2)                     <---------ARR11(3)
----AHL20(2)                            --------->GATA12                       --------->ARR11(3)
--->AHL20(2)                            <---------ARR11(2)                     --------->ARR11(2)
----ICU4                                --------->ARR11(2)                     <---------GATA12
--->AHL12(1)                        <---------LBD16                            --------->GATA12
--->AHL12(3)                        --------->LBD16                            --------->AGP1
----AHL25(1)                       <---------LBD16                             <---------RVE1(2)
----AHL12(1)                   ------->TEIL   <------ZmHOX2a(1)                <---------ARR11(2)
----AHL25(3)          <------------CBF  <---------ARR14(2)                     <---------AGP1
--->AHL25(3)          --------------------->WRI1                     <---------ICU4
---ATHB12         <---------ANAC55(2)   <---------GATA12             --------->YAB1        <--------
------->AHL25(1)  --------->ANAC55(2) <------NtERF2                 <---------YAB5      --------->ARR11(2)
---ATHB51    --------->DOF5.7(1) *TSS--------->LBD16                <---------YAB1      <---------ARR11(2)
-->AHL25(3)---------->DOF2   --------->YAB5<---------HSFB2a(2)    --------->YAB1<------ZmHOX2a(2)
-->ICU4------>MYB83  --------->ATHB12------>NtERF2         --------->ANAC58    --------->RVE1(2)
->CBF<---------MYB46(2)<---------WOX13(1) ------>ZmHOX2a(2)--------->ANAC58   <---------CCA1(2)    <
 
ttttattaccaaacaaaagacacttgattgaatgaatcgccgggatcgaggagattagtagtaagcacatcatcatcactcagatctagtagttccacaa  6949100
                                                                                             -------
                                                                     --------->KAN1         <-------
                                                                    <---------TOE1(2)     ------>MYB83
                                                                    ------->TEIL  ------>ZmHOX2a(2)<
                                                                    <-------TEIL --------->At4g35610
                                                                    --------->SPL7(1)     -------->P
                                                                   <---------SPL1(1)      --------->MYB52(1)
                                                                   <---------MYB52(1)    --------->MYB55(1)
                                                                  <---------SPL7(1)     --------->AtMYB61
                                                                 <---------ANAC58<------ZmHOX2a(2) -
                                                                 <---------ANAC58--------->CCA1(2) <
                                                                --------------->AtSPL3  <---------MYB46(2)
                                                              --------->GATA12  --------->AGP1     -
                                                              <---------ARR11(2)<---------AGP1------
                                                              <---------ARR14(2)--------->GATA12<---
                                                              --------->ARR14(2)<---------RVE1(2)<--
                                                              --------->ARR11(2)<---------GATA12----
                 ----------->GT1                              ------------------>SPL14------->TEIL -
             <---------WRKY18(1)                             --------->ATERF1(1)--------->ARR11(3)<-
            ----------->HVH21                                --------->KAN1     <---------ARR14(2)--
            --------->WRKY38(1)                            <---------ANAC58     <---------ARR11(3)<-
            --------->WRKY45                               <---------ANAC58     --------->ARR14(2)--
            --------->WRKY12                              <------NtERF2        --------->GLK1(1)----
           --------->DOF5.7(2)                          <---------DEAR3(1)     <---------GLK1(1)<---
         <---------MYB46(3)                         <------ZmHOX2a(1)<---------HSFB2a(1)<---------MYB111(1)
         --------->MYB52(2)           ----------->GT1--------->ALFIN1--------->HSFB2a(1)<---------MYB59
     <---------MYB46(3)             ----------->GT1 =====================================HOX2a_HOX2a
-HSFB2a(2)<-------GAMYB            --------->DOF5.7(1)  --------->ALFIN1   --------->LBD16------>MYB46(1)
<<<<<<<<<<<<<<<<LFY              ---------->DOF2    ====================================HOX2a_HOX2a<
 
actcacattgggtcgttgaccagaaaaacacacagagaaaggagaaaaacatggaggagttggcgcatccgtacgttccgagagatctgaacctacccgg  6949200
        --------->YAB1
      ------>MYB83
      ------>MYB46(1)
     --------->WOX13(1)
  ------->TEIL
-->LBD16--------->TOE2(3)
--LBD16 --------->RVE1(2)
---------ANAC58
-------->ANAC58
---------ANAC58
-------->ANAC58
--->LBD16
------ARR14(2)
-------KAN1
----->ARR11(2)                                 --------->ARR14(2)
-------->ANAC55(2)                             --------->ARR11(2)
------TEIL                                     <---------ARR14(2)             <---------ANAC58
------------->AtSPL8                           <-----------ARR10         ----------->RAV1(2)
--------------AtSPL3                    ------->TEIL                   --------->O2               --
------------->AtSPL3                    -------->P       --------------------->WRI1               <-
----->ARR14(2)                          =========================================MYC_MYB     <------
------ARR11(2)                      --------->RVE1(2)   <---------DOF5.7(1)   <---------ANAC58  <---
---------ANAC55(2)      ------>ZmHOX2a(1)      <---------ARR11(2)      --------->TGA1a  <---------MYB52(1)
 
atacgtaccaatctcaatgtcaatgtcctccatcgtctctatctacctcggttcttccctccttgttgtctccctcgtctggcttctcttcggtatttcc  6949300
                                                                                       >>>>>>>>>>WRKY11
    <---------ALFIN1                                                                   >>>>>>>>>>WRKY6
------->ANAC46                                                                        --------->WRKY38(1)
--------ALFIN1    --------->HSFB2a(2)                        --------->DAG2      ---------->DOF2
-----GT1          <---------HSFB2a(2)               ----------->GT1      <-----------GT1  <---------MYB59
------ALFIN1<---------CCA1(2)              <---------At4g35610      ------>ZmHOX2a(2) --------->WRKY12
 
cactccccctccctcatctctctcgaaacgttttaagttgaaattgaactgatggaagtaacaaaaattgatctatttactctgcaaagttgacccaatt  6949400
                        <---------LBD16
                  <------MYB46(1)
                  <------MYB83
                  <---------MYB46(3)
                  --------->MYB52(2)
                <--------P
               <---------ANAC58
               <---------ANAC58                                       <---------RVE1(2)
              <---------MYB46(3)                                    <---------ZAT18
              --------->MYB55(2)                                 <------MYB46(1)
              --------->ATHB12                                   <---------MYB46(3)
              <------MYB83                                       <------MYB83
              <------MYB46(1)                                   <---------MYB46(3)
            <---------WOX13(1)                                  <---------AtMYB61
          --------->ATHB12                                   --------->ALFIN1                     <-
         <---------YAB1<---------LBD16                       <-----------RAV1(1)                  --
       <---------At4g35610    <------ZmHOX2a(1)        <---------ANAC46                        <----
   <---------KAN1<---------AtMYB61---------->DOF2      <---------ANAC58                      -------
  --------->GLK1(2)    <-----------RAV1(2)             <---------ANAC58--------->KAN1   --------->YAB1
 
ctgagaattttgctgattggttggtttcagggaggaagaaagctaaacttgataagttgcttatgtgttggtggacattcactggtctcactcatgttat  6949500
<- Previous    Next ->

AGI:  At1g20040.1   
Description:  pre-tRNA. tRNA-Leu (anticodon: CAA)
Range:  from: 6948851    to: 6948934    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At1g20050.1   
Description:  HYD1 (Hydra 1). Identical to Probable 3-beta-hydroxysteroid-Delta [Arabidopsis Thaliana] (GB:O48962;GB:Q9SAQ8); similar to unnamed protein product [Vitis vinifera] (GB:CAO21915.1); contains InterPro domain Emopamil-binding; (InterPro:IPR007905)
Range:  from: 6949034    to: 6950310    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version