AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
   <---------O2
 <-----------GT1
----->AHL20(3)             <---------AHL12(2)
------AHL25(1)             --------->AHL20(1)
------AHL20(2)             --------->AHL25(2)
------YAB1                 --------->AHL20(3)
----->AHL12(3)             <---------AHL25(2)
------AHL20(3)             <---------AHL20(3)
-->AHL20(2)               --------->AHL12(2)
---AHL20(2)      <---------ICU4
-->AHL20(1)    --------->WOX13(2)
---AHL20(1)    --------->AHL12(2)
---AHL25(3)    <---------AHL12(2)
-->AHL20(3)   <---------AHL20(3)
---AHL25(2)   <---------AHL12(3)
-->AHL25(2)   --------->AHL20(3)
---AHL20(3)   <---------AHL25(1)
-->AHL25(1)   <---------AHL25(2)         <---------AHL20(1)
->AHL20(2)    <---------AHL25(3)         <---------AHL20(3)
->YAB1        --------->AHL12(3)         <---------AHL20(2)
->AHL12(1)    <---------AHL20(2)         --------->AHL20(2)
--AHL12(1)   --------->AHL25(3)          --------->AHL20(1)
->AHL12(3)   --------->AHL20(2)          --------->AHL25(3)
--AHL25(1)   <---------AHL25(1)          --------->AHL20(3)
--AHL20(2)   --------->AHL25(1)          --------->AHL25(1)
--AHL25(3)   <---------AHL25(3)          --------->AHL25(2)
->AHL25(3)   <---------AHL20(2)          <---------AHL25(1)
--AHL12(3)  --------->AHL12(3)           <---------AHL25(2)                <---------KAN1
->AHL25(1)  --------->AHL20(3) ----------->GT1       <---------YAB5       --------->GLK1(2)
>ICU4       --------->AHL25(3)<---------TOE2(3)<-----------GT1          <------ZmHOX2a(1)
-YAB5     <---------KAN1  --------->YAB1--------->YAB1            --------->ALFIN1
 
ttattcacttggcatattaattttcacaaaaataatgttactaatataatatactaatcgtgttgaaatgtgtgaggaatctatatatgtgaataaacta  5696900
                                                                                             -------
                                                                              --------->YAB1 -------
                                                                             <---------YAB1  <------
                                                                            --------->AHL20(2)  <---
                                                                            <---------AHL20(2)------
                                                                            --------->AHL20(3)<-----
                                                                            <---------AHL25(2)------
                                                                            --------->AHL25(2)------
                                                                            <---------AHL25(1)<-----
                                                                            <---------AHL20(3)<-----
                                                                           --------->YAB1    <------
                                                                          <---------YAB1     -------
                                                                         --------->AHL20(3)  <------
              ----------->GT1   <---------AHL20(2)                       --------->AHL25(2)  -------
            ---------->DOF2     <---------AHL20(3)                       --------->AHL20(2)  -------
      --------->YAB1           --------->AHL12(1)                        <---------AHL25(2)  <------
     <---------YAB5          <---------RVE1(2)        <---------KAN1     <---------AHL20(3)  <------
  --------->KAN1       <-----------RAV1(1)  --------->KAN1             --------->ICU4 --------->ZAT18
  --------->AHL12(1) --------->YAB1        --------->DOF5.7(1)       --------->YAB5   <----------ID1
  --------->ICU4   --------->ARR11(3) <---------TOE2(3)            --------->RVE1(2)  <---------ZAT18
 
ttgaaataatcgtagaaaagaaaatcatgttggatttttttgacgaaaaatgctggaatttgttttttaaaatcaatattataatcaagtggacaaataa  5697000
      <----------DOF2
     <---------ICU4
     <---------DOF5.7(1)
 <-------TEIL
-->AHL25(1)
-->AHL20(2)
---AHL20(2)                                 --------------->AGL15----------------->AGL1
------WOX13(1)                        <---------AHL25(3)         <-----------------AGL1
--->ATHB51                           <---------AHL25(3)     --------->ATHB51
----AHL25(3)                         --------->AHL12(1)     -------->ATHB1
-->HAHB4                             <---------AHL25(2)     <---------ICU4
--->ATHB12                           --------->AHL25(3)     --------->ATHB12
---ATHB1                             <---------AHL12(1)    <---------YAB5
----ICU4--------->ATHB12             --------->AHL25(1)    <---------YAB1                         --
---AHL25(1)                          <---------AHL20(2)    --------->AHL12(1)                     --
-->AHL25(3)           --------->YAB1 <---------AHL25(1)    --------->ICU4                       <---
---ATHB51<---------WOX13(2)   --------->DOF5.7(1)    <------ZmHOX2a(1)                   ---------->DOF2
-->AHL12(1)    --------->ANAC58      --------->AHL25(2)    <---------KAN1             --------->YAB1
-->ICU4<---------YAB1 ----------->GT1--------->AHL20(2)   <---------AHL12(2) <---------YAB1  -------
---AHL12(1)    --------->ANAC58     --------->AHL25(3)    --------->AHL12(2) <---------KAN1---------
---ATHB12--------->WOX13(2)   ---------->DOF2    --------->DOF5.7(1)   --------->RAP2.6(3)--------->DAG2
 
ttggttcatctttattgaacgcctatagtaaaaaaaagaattaattcccaagaagaggaagaattattgcccatgaaggcatgaatgaagcataaagtta  5697100
                             ------->TEIL
                             --------->RVE1(2)
                     ---------->DOF2
                   --------->AHL20(2)
                 <---------WOX13(2)
                 --------->WOX13(2)
                --------->YAB5
                <---------ICU4<---------KAN1
                <---------AHL25(3)          --------->WOX13(2)
               --------->AHL25(1)           <---------WOX13(2)
               <---------AHL25(1)          <---------ICU4
               --------->AHL25(3)          --------->ATHB12
     --------->WOX13(2)      <---------GATA12
     <---------WOX13(2)     <---------CCA1(2)
    <---------ICU4 <---------AHL20(2)      --------->ATHB51
   --------->ICU4<---------AHL12(2)       <---------YAB1                                --------->DOF5.7(1)
 --------->YAB1<---------ATHB51           --------->ICU4                              --------->DOF5.7(1)
--------->ZAT6 --------->ICU4--------->GATA12                                     <------ZmHOX2a(1)
------->YAB1   <---------AHL20(2)       --------->YAB1               ---------->DOF2  ---------->DOF2
------>HAHB4   --------->AHL20(2)   <---------ICU4               >>>>>>>>>GATA-1 ----------->GT1
------WOX13(2) <---------ATHB12    --------->ICU4              ----------->GT1  <---------TOE2(3)
-->AHL20(2)    --------->AHL12(1)  <---------YAB1        <------ZmHOX2a(1) --------->DAG2
-->GT1         <---------AHL12(1)--------->YAB1         ----------->GT1   ---------->DOF2  ---------
 
ataatactaattagtcaaataattaaaagtcgaatctcataattcataattgaaacacgaggaaaatagataaaaagaaaagtaaggaaaaaagaagagg  5697200
                                         <---------ANAC58
                                         --------->ANAC55(2)
                  <------NtERF2          <---------ANAC55(2)
                  --------->ATERF1(1)    --------->O2
                 ------>NtERF2           <---------ANAC55(1)
                 <---------ATERF1(1)     <---------ANAC58
               <------NtERF2             <---------O2
              <---------MYB46(3)         <---------TGA1a
             <---------DEAR3(1)          <---------bZIP60(2)                   ----------->RAV1(1)
            <------NtERF2                <---------bZIP60(1)                  <---------ALFIN1
            --------->ATERF1(1)          --------->bZIP60(1)                ------>NtERF2
           <---------SPL7(1)             --------->TGA1a                    <---------ATERF1(1)
           <-----------HVH21             <---------ANAC46          <---------DAG2--------->AtMYB61
          <---------MYB46(3)           <---------TGA2(2)       --------->WRKY12------>NtERF2
       <------MYB46(1)                ----------->TGA1 --------->WRKY38(1)  --------->LBD16
       <------MYB83                --------->DAG2      <---------KAN1      --------->ANAC46
      --------->MYB59            ---------->DOF2    --------->ATHB12<---------DOF5.7(1)
      <---------AtMYB61          ==================bZIP_DOF  <------------CBF --------->DEAR3(1)
   --------->GATA12  <---------At4g35610 =====================================bZIP_DOF
   <---------RVE1(2)--------->ANAC58  ----------->HVH21----------->HVH21   --------->ANAC58
   <---------ARR14(2)<---------ZAT2--------->DOF5.7(1) --------->WRKY12   --------->MYB46(3)
   --------->ARR14(2)<------NtERF2--------->DOF5.7(1)<------------CBF  <-----------GT1
   --------->ARR11(1)--------->At4g35610----------->STF1<---------WRKY18(1)--------->ANAC58
   <---------GATA12 --------->ANAC58 <-----------HVH21<---------WOX13(1)  <---------LBD16
>DOF5.7(1)<---------DEAR3(1)   <---------AHL20(2)  <---------YAB1  <----------DOF2             <----
 
gtagtagatttggtcgtcgggggcagcaacgtattaaaaaggtgacgtgagattacgattgacccattgactttttacccgccaccataagaagaccgtc  5697300
                                                          ------>ZmHOX2a(2)
                                                        <---------GATA12
                                                        --------->GATA12
                *TSS                            ------>ZmHOX2a(1)
               --------->KAN1                   =================HOX2a_HOX2a
          ------>ZmHOX2a(1)                    --------->TOE2(3)
         --------->TOE2(3)                     --------->TOE1(3)  --------->ANAC46
 <---------DOF5.7(1)                        --------->ARR14(2)  <---------ALFIN1                   <
------>ZmHOX2a(1)                           <---------ARR14(2)  --------->ANAC46             -------
-----DOF5.7(1)<---------YAB5             --------->MYB46(3)   <---------ALFIN1            <---------ZAT6
 
ttcctcttccttccttattcattcgtcttcagtcttccatttcaacaaatccttaatctgatctcacacacggcgagacacacatatagaatagagatag  5697400
                       <-------MYC3
                       ------->MYC3
                       ------->MYC2
                 --------->ANAC58
                 --------->ANAC58
                --------->DAG2
               ---------->DOF2
              <---------KAN1
            <---------ANAC55(2)
            <---------ANAC46<---------DOF5.7(1)                                         <-----------GT1
            --------->ANAC55(2)  <-----------GT1                                    <----------DOF2
      <---------YAB1   <-------MYC2                             <-----------GT1 --------->ARR14(2)
---------At4g35610    --------->KAN1   --------->ZAT6          <---------AHL20(2)   ------>ZmHOX2a(1)
-->CCA1(2)------>ZmHOX2a(2)<----------DOF2  --------->ANAC46   <-----------GT1  <---------ARR14(2)
 
acagcgactctgatcgcgtaaagccacatgctttttatacaaactctacccaaataccaagtttttttaatctcccatttctgaatccttttctctctct  5697500
                                             =============================================bZIP_DOF
                                             ===============================bZIP_DOF
                                             <---------ZAT2
                                             <---------TGA1a
                                             <---------ANAC46
                                             =======================bZIP_DOF
                                             --------->ZAT2
                                       --------->GLK1(2)
                                     <---------HSFC1(2)
                                     <---------HSFB2a(1)
                                     --------->HSFC1(2)
                                     --------->HSFB2a(1)
                                  <------ZmHOX2a(1)
                                <---------TOE2(3)
                            <---------WOX13(2)
                            --------->WOX13(2)
                          <---------------AGL15
                         --------------->AGL15
                        ----------------->AGL1
                        ----------------->AG <---------bZIP60(2)                        <---------ANAC46
                        <-----------------AGL3          <---------DOF5.7(1)             <---------ANAC58
                        ----------------->AGL3     <---------GLK1(1)                    <---------ANAC58
                        ----------------->AGL2   <------MYB83<----------DOF2   <----------DOF2
                        <-----------------AG <---------O2<----------DOF2      <---------DOF5.7(1)  <
                        <-----------------AGL2   <------MYB46(1)      <----------DOF2  <------NtERF2
             <-------TEIL<---------------AGL15 --------->ALFIN1  <----------DOF2     <---------RAP2.3(3)
 
ctctctcgattctagcttcatcgctgttccaaatttaggaagtttctgaggtgggtttctctttctttctttcctttctcgtcttttggctgcgtctgtt  5697600
                                                                       <---------ARR11(3)
                                                                       <---------RVE1(2)           -
                                                                       --------->ARR11(3)<---------ANAC58
                                                                       <---------GLK1(2) <---------ANAC58
                                              <----------DOF2        <---------TOE2(3)   <---------ANAC46
---------TOE1(2)             --------->KAN1  <---------DOF5.7(1)     <---------TOE1(3)----------->HVH21
 
tctaggttttgttctgagtcttgacaaaacccaaattccaagttcacatcttttctagttgttttcatgtttaagatttttggtcccttctgacttggac  5697700
                                         <---------ANAC58            --------->RVE1(2)         -----
                                         <---------ANAC58            --------->GATA12      <--------
                                  --------->GATA12                  <---------CCA1(2)      ---------
                                  <---------GATA12             --------->ANAC58           --------->ATHB12
                                  <---------AGP1           <-----------GT1               <---------AHL20(2)
                                  --------->ARR11(3)     <---------WOX13(2)              --------->AHL12(1)
                                  ------->TEIL          >>>>>>>>>>AtMYB44                --------->AHL20(2)
                                  <---------ARR11(3)    --------->MYB59                  <---------AHL25(1)
           ================================HOX2a_HOX2a  ----------->GT1                  <---------AHL12(1)
           <------ZmHOX2a(1)      --------->ARR11(2)    --------->MYB111(1)             <---------WOX13(1)
         <---------TOE2(3)        <---------ARR11(2)    --------->MYB52(2)            --------->YAB5
 --------->GLK1(2)      <---------WOX13(2)    <---------DAG2   --------->ANAC46      <---------YAB1
<---------RVE1(2)       --------->WOX13(2)    <----------DOF2  --------->ANAC58    <---------At4g35610
<---------GLK1(2)     <---------YAB5   >>>>>>>>>>AtWER  --------->MYB46(2)       <---------ANAC58
-------->KAN1         --------->ICU4------>ZmHOX2a(2)------------>MYB.PH3(2)     <---------ANAC58 <-
 
atagattctattgaggaattgagtagtaattgaaatggatctatgcctgctttactagttagttacaagtcaaatctctgaattgcttctgattaattgc  5697800
<- Previous    Next ->

AGI:  At1g16670.1   
Description:  protein kinase family protein. similar to protein kinase family protein [Arabidopsis thaliana] (TAIR:AT3G09010.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN64306.1); contains InterPro domain Protein kinase, core; (InterPro:IPR000719); contains InterPro domain Protein kinase-like (InterPro:IPR011009); contains InterPro domain Serine/threonine protein kinase, active site; (InterPro:IPR008271)
Range:  from: 5697317    to: 5699762    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version