AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                       --------->TOE2(3)
                      --------->YAB5
                      --------->ATHB12
                      <--------HAHB4
                      --------->YAB1
               --------->ATHB51
               --------->AHL25(1)
               <---------AHL25(1)
               <---------AHL25(3)
               -------->ATHB1
               <---------AHL20(2)
               --------->AHL20(2)
               <---------AHL12(1)
               --------->AHL12(1)
              --------->ICU4
              <---------ATHB51
              --------->AHL25(3)                ----------->GT1
            --------->YAB5                   <-----------RAV1(1)
          ------>MYB46(1)                <---------------AGL15
          ------>MYB83<---------ICU4     --------------->AGL15
         ----------->RAV1(1)            <-----------------AGL1
       --------->DEAR3(2)               ----------------->AGL1
       <---------MYB55(2)               ----------------->AGL2        --------->ATHB12             <
       --------->MYB46(3)               <-----------------AG         --------->AHL12(1)           --
 <-----------GT1     <---------YAB1     >>>>>>>>>E2Fc                --------->AHL20(2)           <-
-------->AHL12(1)    <---------YAB5     >>>>>>>>>E2Fd                <---------AHL20(2)           <-
---------AHL25(3)  --------->YAB1       ----------------->AGL3   <---------YAB1                   --
------->AHL12(1) <---------AHL12(2)    ------>NtERF2      <---------DOF5.7(1)                     <-
--------AHL12(1) --------->AHL12(2)    --------->LBD16   <---------DOF5.7(1)           <---------ANAC58
------->AHL12(2)<---------AHL12(2)    --------->ANAC58   <----------DOF2               <---------ANAC58
--------AHL12(2)--------->AHL12(2)    --------->ANAC46  --------->TOE2(3) <---------AHL20(2)      <-
------>AHL12(1)<--------HAHB4         --------->ANAC58  <---------DOF5.7(1)   --------->YAB1      --
 
aatttttcgaaccaacaattatttatcattagcgcttgctcccgccaaatgtggcaaaacctttttctatgatttattgaattataagttacttacattt  5133300
     --------->ARR11(2)
     --------->ARR14(2)                                                                    <--------
     <---------GATA12                                                                    --------->YAB1
     --------->GATA12                                                                  <---------AHL12(2)
  ------>ZmHOX2a(1)                                                                   <---------AHL12(2)
------>ZmHOX2a(2)                                                                     --------->AHL12(2)
------ZmHOX2a(2)                                                                     <---------AHL12(1)
------->GATA12                                                                       --------->AHL12(1)
--------RVE1(2)                                                                      --------->AHL25(3)
--------GATA12             ----------------->AGL1                                    --------->AHL20(2)
------->ARR11(2)      <---------bZIP60(2)                                        --------->ANAC58
--------ARR11(2)      --------->O2                                               --------->ANAC58
--------ARR14(2)      <---------O2            ----------->RAV1(1)                ----------->GT1  <-
------->ARR14(2)  <---------At4g35610 <-------TEIL                    <-------TEIL <---------ARR11(3)
 
ggatcctcgatctacaatctcagcgacttggccaaatgtgatacatggacaacataatgtgatacaacctgcattcattttggcaagataaattataagt  5133400
         <---------AHL12(2)
         --------->WOX13(2)
         --------->AHL12(2)                                                    --------->YAB1
        <---------AHL20(2)                                                    <-------TEIL
        <---------AHL25(3)                                         --------->RVE1(2)
        --------->AHL12(3)                                         <---------ARR14(2)
        <---------AHL25(2)                                         <---------ARR11(2)
        <---------AHL12(3)                       ------>ZmHOX2a(2) <---------ARR11(1)
        <---------AHL20(3)                      <------ZmHOX2a(2)  --------->ARR11(3)
        --------->AHL20(3)                     --------->GATA12    <---------ARR11(3)    <---------ANAC46
        <---------AHL25(1)                     <---------GATA12    --------->ARR14(2)    <---------ANAC58
       <---------AHL20(2)                      <---------ARR11(2) <---------ARR14(1)     <---------ANAC58
       --------->AHL20(2)                      --------->ARR11(2) <---------KAN1         <---------ANAC55(2)
       --------->AHL25(1)   ------>MYB46(1)    ------->TEIL ---------->DOF2  --------->AtLEC2
-YAB1  --------->AHL25(3)   ------>MYB83       --------->ARR14(2) --------->GLK1(1)      <---------ANAC55(1)
---------DOF2             <---------MYB59      <---------ARR14(2) <---------CCA1(2)      --------->ANAC55(2)
 
actttggctattaattttcagaaattagaccaaattgatgaagaaatatggatccaaagtattgaaagcatatctattacatgcataacattacttgttt  5133500
                                         <---------AHL20(2)
                                         --------->YAB1
                                       --------->AHL20(3)
                                       <---------AHL20(3)
                                       --------->AHL12(3)
                                       <---------AHL12(3)
                                     <---------AHL12(1)
                                     --------->AHL12(1)
                                     <---------AHL20(2)
                                     --------->AHL12(3)
                                     <---------AHL12(3)
                                    --------->AHL20(1)
                                    <---------AHL20(1)
                                    --------->AHL25(3)
                          --------->AHL12(3)
             --------->ANAC46      <---------AHL12(2)
             --------->ANAC58      <---------AHL12(3)
             --------->ANAC58 <---------AHL20(2)   ----------->GT1
           <---------ALFIN1  --------->AHL20(2)   --------->ICU4   <---------At5g28300       -------
         --------->ANAC46 <---------AHL12(3)   <---------AHL20(2) <-----------GT1           <-------
     <-----------GT1      --------->AHL20(2) --------->ANAC55(2)<---------WOX13(2)        --------->WOX13(1)
 <---------RVE1(1)        <---------AHL20(2) --------->ANAC46   --------->WOX13(2)     --------->ANAC58
<---------GLK1(2)--------->ANAC58  --------->AHL12(2)       ----------->GT1            --------->ANAC58
<---------RVE1(2)--------->ANAC58 --------->AHL20(1)      ----------->GT1            ---------->DOF2
--------->GATA12 <---------ALFIN1 <---------AHL20(1)     --------->DAG2            <----------------
--------->ARR11(3) --------->ANAC46--------->AHL12(3)   ---------->DOF2        <-----------HVH21
 
tcagatttttacacacacgcacacactatatatataatatatatttataagtaattgtgaaaagtgtaattacagtttcggcagtcagagaagcaatcac  5133600
      <---------ETT(2)                                                                --------->ANAC58
      <---------ZAT18                                     ----------->GT1    --------->AHL20(2)
      --------->WRKY38(1)          <---------AtLEC2  --------->AtLEC2        <---------AHL20(2)
-->YAB1                       <---------ANAC58     <---------AtLEC2    ----------->GT1--------->ANAC58
--ATHB12       <---------YAB1 <---------ANAC58<---------At4g35610   --------->DOF5.7(1)            <
-----WRI1 --------->YAB5 <---------KAN1       --------->At4g35610 ---------->DOF2   ---------->DOF2<
 
agaagcctgtggaccattctccttgagcatgaggcttggcatgaagttgagcttccatggagagaaaaataaagaggtttttaaatagaaagcaatgtgt  5133700
                                                          <---------AHL12(2)
                                                         <---------AHL25(2)
                                                         --------->AHL12(2)
                                                         --------->AHL20(3)
                                                         <---------AHL20(3)
                                                         --------->AHL25(2)
                                                <---------ICU4
                                               <---------AHL25(1)
                                               --------->AHL25(3)
                                               --------->AHL20(2)
                                              <---------AHL12(3)
                                              --------->AHL12(3)
                                              <---------AHL25(2)
                                    <---------AHL20(2)   <---------AHL20(1)
                                  <-----------TBP       --------->AHL20(2)
                            <---------ANAC46  --------->AHL25(2)
                            <---------ANAC58  --------->AHL12(2)
                            <---------ANAC58  --------->AHL25(3)                   <----------DOF2
                          <---------YAB1      <---------AHL12(2)          --------->ARR14(2)
                        --------->YAB1       --------->YAB1               <---------ARR14(2)
          *TSS         <---------YAB5        --------->AHL12(2)      <-----------HVH21
       ----------->HVH21--------->YAB5      <---------KAN1<---------YAB1  --------->ARR11(2)
---------TOE1(3)       <---------KAN1  --------->YAB1   --------->ATHB51<---------DEAR3(2)   -------
---------TOE2(3)     --------->YAB1 --------->YAB1     <---------MYB52(1) <---------ARR11(2) -------
 
ttaaggttttgtgacataaacgaagaatgatgcttgtatttataagaatattaattccattatttttgaactcgtcggaacctcgacttttaaaaatcat  5133800
                                                                      <---------KAN1
                                                                    ----------->GT1
                                                                   <------ZmHOX2a(1)
                                                                 <---------TOE2(3)
                                                             <----------DOF2
                                                             <---------------AGL15
                                                             --------------->AGL15
                                                      <---------AHL25(1)
  --------->DOF5.7(1)                                 --------->AHL12(1)
  ---------->DOF2                                     <---------AHL12(1)
-->YAB5                                               <---------AHL20(2)            <----------DOF2
-->YAB1                      ---------->DOF2         --------->AHL25(3)    <-----------GT1
 
aaaaaaaaagtctcaagtttttgttttatcttgaaagtagccatcaccatttactaaatatttgctttaaggagtatataaccaagtctttctagttttt  5133900
                                                                                               <----
                                                                                               <----
                                                                                              <-----
                                                                                              ------
                                                                                              <-----
                                                                                  --------->ARR11(3)
                                                                                  <---------GLK1(2)
                                                  ----------->GT1               ----------->ARR10
                                       --------->ATHB12                         --------->ICU4<-----
                                      --------->ICU4                            <---------YAB5<-----
                                      <---------YAB5                          ---------->DOF2 ------
                                      <---------YAB1                 <---------YAB1      --------->AtLEC2
                                     <---------TOE2(3)           <---------RVE1(2)<---------ARR11(3)
            --------->GLK1(1)     <---------RVE1(2)              <---------GLK1(2)<---------RVE1(2)
 
tttgtttttcttaagaaatctattttagtttgtaatggataatgtttgataaatcgaaataacatatggattttcatttagtaaagattttcatgcagat  5134000
                                                            <-----------GT1
                                                 <-----------GT1
                                               <---------AHL12(1)
                                               --------->AHL20(2)
                                               <---------AHL20(2)
-----RVE1(1)                                   --------->AHL12(1)
-----CCA1(1)                  --------->DAG2 <---------WOX13(2)
----ARR11(2)                 ---------->DOF2 --------->AHL12(2)
--->ARR14(2)           ----------->GT1       --------->WOX13(2)      --------->ZAT14
----ARR14(2)       --------->ARR11(3)      --------->AHL20(2)        <---------ZAT14             <--
----RVE1(2)       --------->YAB1           --------->AHL25(3) --------->ZAT6                    ----
----ARR11(3)     <---------YAB5            <---------AHL20(2) --------->ANAC46           ---------->DOF2
--->ARR11(3) <---------AHL12(2)     --------->AHL12(2)   <-----------GT1   <----------DOF2 ---------
 
atttcatggagagatttataaacatattggaaaaaagtttttttttttaatttatcagttttatcacactactacacactttaacttataagaaaagttt  5134100
                                                                                             <------
                                                                                             <------
                                                                                            <-------
                                                                                            --------
                                                                                            <-------
                        --------->CCA1(2)                                                   <-------
                      <------ZmHOX2a(1)                                      <---------TOE1(2)
                    <---------TOE2(3)            <--------P          ------>NtERF2          <-------
               --------->AHL20(2)     <---------GATA12              --------->LBD16         --------
               <---------AHL20(2)     <---------ARR11(2)            <---------ZAT18         --------
               <---------AHL25(1)     --------->ARR11(2)           <---------ANAC58       --------->AHL12(2)
-------YAB1    --------->AHL25(1)     <---------ARR14(2)           <---------ANAC46       <---------WOX13(2)
----->AHL12(2)--------->AHL20(2)      --------->ARR14(2)           <---------ANAC58       <---------AHL12(2)
-->GT1        --------->AHL25(3) --------->MYB52(1)               <---------LBD16         --------->WOX13(2)
 
atttttgtcttcccccatttatttaggatataatgtaaacggattcaaatgggttagtccgtttaagcctgcgggcttagcaggtttgatgaaaattaaa  5134200
<- Previous    Next ->

AGI:  At1g14880.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G14870.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO42338.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO42335.1); contains InterPro domain Protein of unknown function Cys-rich (InterPro:IPR006461)
Range:  from: 5132530    to: 5133711    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version