AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                <---------AHL25(1)
                                                                --------->AHL12(1)
                                                                <---------AHL12(3)
                                                                --------->AHL12(3)
                                                                <---------AHL25(3)
                                                                --------->AHL25(1)
                                                                <---------AHL12(1)
                                                                --------->AHL20(2)
                                                               --------->AHL20(3)
                          <------MYB46(1)                      <---------AHL20(1)
                          <------MYB83                         <---------AHL20(2)
                         --------->MYB46(2)                    --------->AHL12(1)
                         --------->MYB111(1)                   --------->AHL25(2)
                         --------->MYB52(2)                    <---------AHL20(3)
                         --------->MYB59                       <---------AHL12(1)
                       <<<<<<<<<MYB98                          --------->AHL25(3)
                  <---------ARR14(2)                    --------->YAB5
                  --------->ARR11(2)                 ----------->GT1
                  <---------ARR11(2)               ---------->DOF2
             --------->PCF5                       <------ZmHOX2a(1)
           <---------ANAC58       <---------KAN1<---------TOE1(3)        <---------LBD16
           <---------ANAC58  <-------TEIL<------ZmHOX2a(2)     <---------AHL25(2)
        --------->ALFIN1<---------MYB55(1)      <---------TOE2(3)<---------AHL25(3)
      <------ZmHOX2a(1)<---------MYB52(1)================HOX2a_HOX2a  <---------At4g35610--------->STY1(1)
<---------LBD16   --------->RVE1(2)     --------->ARR11(3)     --------->AHL20(1)        <---------STY1(1)
---------->RAV1(2)--------->ARR14(2)    <---------ARR11(3)    --------->AHL12(2) <---------At5g28300
 
aaacctggaggatggggtccctatccgttaggttcggatgagagatcatttaaggaaagtgactaaaatatttagcttcggagttaccgagcctagggct  3057600
                                            ----------->RAV1(2)
                                            --------->At4g35610
                                            --------->ZAT2
                                        --------->ANAC58
                                        --------->ANAC58
                                        --------->ANAC46
                                       ------>MYB46(1)                                      <-------
                                <---------MYB52(2)                                         <--------
                               --------->At4g35610       --------->WOX13(2)                ---------
                            --------->LBD16 <---------At4g35610                            ---------
                           <---------ANAC55(2)<-----------RAV1(1)                          <--------
                        <---------ARR11(2)  <---------KAN1<---------MYB59                  ---------
                        --------->ARR14(2) <---------ARR14(2)                              ---------
                        <---------ARR14(2) ------->TEIL  <---------WOX13(2)           --------->At5g28300
                        ------->TEIL   ------>MYB83      <---------At4g35610       <---------LBD16
                        --------->GLK1(2)  <---------GATA12          <------MYB83 <---------ANAC46
                        --------->ARR11(2) --------->ARR11(2)        <------MYB46(1)  <------NtERF2
                   <-----------GT1   --------->TOE1(2)   --------->At4g35610  <---------ZAT14
                   --------->MYB52(1)--------->TOE2(2)  --------->MYB59       --------->ZAT14
              ---------->DOF2 --------->RVE1(2)       <---------MYB52(1)  <---------WRKY18(1)    <--
             <---------AHL20(2)<---------At4g35610 <------NtERF2    <---------TOE1(2)----------->GT1
           <---------WOX13(2) <-----------ARR10   <---------ZAT18<---------STY1(2)<---------ANAC58
 <---------KAN1<---------TOE2(3)<---------MYB59  <---------ANAC46--------->STY1(2)<---------ANAC58
 
tcgaattttgtgtcatttaaagtaacgaatccgtagctaacctacgcatctggcgcagttagctaacttgctaggtttgactgtagcgcggcaaaatcta  3057700
                            --------->ALFIN1
                           <-------PIF5
                           <-------MYC2                                                        <----
                           ------->MYC2                                                   <------ZmHOX2a(2)
                           <-------MYC3                                                  <---------GATA12
                           ------->MYC3                                                  --------->GATA12
                           ------->PIF5                                              --------->ARR14(1)
                           ------->MYC4                                              <------ZmHOX2a(2)
                           <-------MYC4                                              --------->CCA1(2)
                          ==========================================bZIP_DOF        <---------ARR14(2)
                          --------->O2                                              --------->ARR14(2)
                          <---------TGA1a                                           <---------GATA12
   ---------->DOF2        --------->TGA1a                                           --------->GATA12
   =================================bZIP_DOF                                        <---------ARR11(2)
--------------WRI1        <---------ANAC55(2)            <---------DAG2             --------->ARR11(2)
---ARR10                  <--------ABF1                  <---------DOF5.7(1)        <---------ARR11(3)
>RVE1(2)                  <---------O2   <---------DOF5.7(2)                        --------->ARR11(3)
>GATA12                   <---------ANAC46<---------YAB5 <----------DOF2           --------->GLK1(1)
-ARR11(3)            --------->ANAC58   <---------ARR11(2)                         <---------GLK1(1)
>GLK1(2)             --------->ANAC58   --------->ARR11(2)      ------>NtERF2      --------->KAN1
>ARR11(3)          ---------->DOF2   <---------ZAT6   <---------ALFIN1        <---------MYB52(1)
-------YAB5        =================bZIP_DOF       <---------PCF5    --------->RVE1(2)------>ZmHOX2a(2)
 
ttcgttcaaagttcaaactatagaaagccacgtgtgcatagtgtaaacgtagtcggaccacttttgcagccatatcaaaccgttggagatccgatcgaat  3057800
                ---------->DOF2
              <---------AHL20(2)
          <---------RVE1(1)
          <---------CCA1(1)
         <---------ARR11(3)                       <---------ANAC58
         <---------RVE1(2)                        <---------bZIP60(2)
         --------->ARR11(3)                       <---------ANAC46
     ---------->DOF2      <---------ANAC58        <---------ANAC58         ---------->ID1         --
   --------->ANAC58       <---------ANAC58     <-----------RAV1(1)     <----------DOF2           <--
   --------->ANAC58       <---------AtLEC2--------->ARR14(2)--------->ANAC58               ------>ZmHOX2a(1)
   --------->ANAC46  <----------DOF2      <---------ARR14(2)<---------ANAC55(2)       ------>ZmHOX2a(1)
-----KAN1--------->AHL20(1)               --------->GATA12  --------->ANAC58         <---------DOF5.7(1)
 
acaactacgaaagatattaaaaagcttttgcatgagtaatgtcccgatttgtgtcgtgttgataagtaagttatctttttcccttcatcctttcctcata  3057900
                                   <------------CBF
                                  <---------AHL20(2)
                                  -------->ATHB1
                                  --------->ATHB51
                                  -------->HAHB4
                                  --------->ATHB12
                                  <---------ICU4
                                 <---------YAB5
                                 --------->ICU4
                                 <---------ATHB51
                                 <---------YAB1--------->AHL25(3)
                                --------->WOX13(2)
                                <---------WOX13(2)
                                --------->AHL12(2)
      --------->GATA12        --------->AHL20(2)      <---------TOE2(3)                            -
      ------->TEIL      <---------DOF5.7(1)  <----------DOF2           <---------At4g35610         <
 <------------CBF       <---------DAG2     ------->TEIL <------ZmHOX2a(1)     <---------AtLEC2     <
------->YAB1            <----------DOF2 <---------WOX13(1) <---------KAN1 --------->YAB5         ---
-------YAB5----------->TBP    <---------AHL20(2)  <---------YAB1  <---------ZAT6             -------
 
ctcatattgaatctataaacagaacaactttttttaattattgatggacttttattttaggaatgaagagagttagatgatgcatgaaatggcatacaaa  3058000
         --------->DAG2
   --------->ALFIN1                                                                    <---------ARR14(2)
 --------->ALFIN1                                                                      --------->ARR14(2)
-------->ALFIN1                            ------>ZmHOX2a(1)                          ==============
---------ANAC58                  <---------ZAT18                             <---------DAG2
---------ANAC58                  --------->ZAT14                             --------------->AGL15
------>ALFIN1                    --------->ZAT18                             <----------DOF2
--->DOF2---------->DOF2          <---------ZAT14                      <---------ZAT6  <------ZmHOX2a(1)
 
gtgtgtgtggagaaagtgaagagtttgggaattgagttcactactcctatagaagaaaccctcagagacactattgttagccttatggaggattgtcttc  3058100
                                                                     <---------AtLEC2
                                                               <---------AHL20(3)
                                                               <---------AHL25(2)
          <---------YAB5                                       --------->AHL20(3)
       ------>ZmHOX2a(1)                                   --------->YAB1
     ------>ZmHOX2a(2)                                  <-----------GT1                <----------DOF2
   <---------ARR11(3)                        <-----------GT1  --------->YAB1   --------->YAB5
   --------->ARR11(3)         <-------TEIL<---------MYB46(3) <---------YAB1   <---------KAN1
============HOX2a_HOX2a<---------KAN1    <--------P  <---------AHL12(2)     <------ZmHOX2a(1)  -----
 
ttatatgatcctcatcatatataggcatatagcttcattttctggttgtttctattttttaactataattttgtatggaggatgtctaggctttacaata  3058200
                   <---------AHL12(2)
                  --------->AHL12(2)
                  --------->AHL12(3)
                  <---------AHL25(2)
                 --------->AHL25(3)
                 --------->AHL20(2)
            <---------AHL12(2)
            --------->AHL12(3)
           <---------AHL25(3)
           --------->AHL12(2)
           <---------AHL12(2)
          <---------AHL25(3)
          --------->AHL20(2)
          --------->AHL12(1)
          <---------AHL12(1)
          <---------AHL12(3)
          <---------AHL25(1)
          --------->AHL12(3)
          --------->AHL25(1)
         <---------AHL12(2)
         --------->AHL12(2)
         <---------AHL20(1)
         <---------AHL12(1)
         --------->ARR11(3)
         <---------ARR11(3)    --------->ARR11(3)
         --------->AHL12(1)    <---------ARR11(3)
         --------->AHL20(1)    --------->RVE1(2)
         --------->AHL25(3) <---------AHL25(3)
         --------->AHL25(2) <---------AHL25(1)
         <---------AHL25(2) --------->AHL25(2)
        <---------AHL25(2)  --------->YAB1
        --------->AHL12(3)  --------->AHL20(2)
        --------->AHL12(2)  --------->AHL12(3)
        <---------AHL12(3) --------->AHL12(1)                                    --------->O2
     <---------AHL25(3)    <---------AHL20(2)             --------->GLK1(2)      <---------O2
    --------->AHL20(2)   --------->WOX13(2)             <---------AHL12(1) <---------ANAC55(2)
    <---------AHL20(2)   --------->AHL12(2)             --------->KAN1    --------->RAP2.6(3)
  <---------WOX13(2)   <---------AHL20(2)               --------->AHL12(1)<---------LBD16
  --------->WOX13(2)   --------->AHL20(2)        ----------->GT1          <---------At5g28300
 --------->YAB5  <---------AHL20(2)              <----------ID1          --------->MYB52(1)
<---------AHL20(2)<---------AHL12(3)            --------->DOF5.7(1)   <---------------AtSPL3
<---------YAB1--------->YAB1<---------AHL12(2)---------->DOF2        --------->AHL20(2)           --
---->RVE1(2)<---------AHL12(3)--------->CCA1(1)--------->DOF5.7(1)  <---------ATHB12    <---------MYB46(3)
 
tgtataattaaaaatatttataaattttaaataatatctataaactcagaaaaggagaaatattctgaacaatgaattacggcaacgtgatttgttgaaa  3058300
                                                                                       --------->DOF5.7(1)
                                                                        --------->ARR11(3)
                              <---------ANAC46                          --------->ARR14(2)
                              <---------ANAC58                          <---------ARR11(3)
                              <---------ANAC58                          --------->RVE1(2)
                        <----------DOF2                                --------->RVE1(1)
      <-------MYC3    ---------->ID1                       <---------ANAC58   <---------HSFB2a(2)
      ------->MYC3   <-----------GT1                       <---------ANAC58   --------->HSFB2a(2)
------->TOE2(3) --------->AHL12(2)                  <---------DOF5.7(1)--------->CCA1(1)
 
aacttaacatgtggatgttttttttttctttttgcttatgcatataacatgtaggccttatttcttgtttacaaatatcttctaaaactgaagggccagt  3058400
                                   <-----------GT1
                                --------->WOX13(2)
                           <------NtERF2
                          ------>NtERF2 ------>MYB83
                          <---------RAP2.6(3)
                         --------->RAP2.6(2)
                         --------->DEAR3(1)
                         --------->RAP2.3(2)
                        --------->RAP2.3(1)
                        --------->DEAR3(2)
                        --------->ATERF1(1)
                        --------->ORA47(2)
                        --------->ERF1  ------>MYB46(1)
                       <---------At4g35610
                       --------->At4g35610                          <---------ANAC58
                  --------->WOX13(2)  <---------MYB59               <---------ANAC58
                  <---------WOX13(2)  <---------MYB46(2)  --------->ZAT6
                <---------YAB1  <---------WOX13(2)  --------->WOX13(2)
           --------->KAN1--------->RAP2.3(3)        <---------WOX13(2)            <---------RVE1(2)-
 
tttaaacaaggcccatattctaattgagccgccctaatttaccaaaccatttactaattgaacactcccatgcgtttgaagagttgattcttcatttaag  3058500
<- Previous    Next ->

AGI:  At1g09480.1   
Description:  cinnamyl-alcohol dehydrogenase family / CAD family. similar to cinnamyl-alcohol dehydrogenase family / CAD family [Arabidopsis thaliana] (TAIR:AT1G09490.1); similar to unknown [Populus trichocarpa] (GB:ABK95157.1); contains InterPro domain NAD-dependent epimerase/dehydratase; (InterPro:IPR001509); contains InterPro domain NAD(P)-binding; (InterPro:IPR016040)
Range:  from: 3057977    to: 3060663    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version