AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                      <---------LBD16
                                                                                   --------->At4g35610
                                                                                   <---------At4g35610
                                                                                   <---------ZAT2
                                                                                   --------->ZAT2
                                                                                  <-----------RAV1(1)
                                                                                  <---------MYB46(3)
                                                                                  <---------ATERF1(1)
                                                                                 <---------DEAR3(1)
                                                                                ----------->RAV1(2)
                                                                                --------->At4g35610
                       --------->MYB59                                   ------>ZmHOX2a(2)
                       ----------->ARR10                               --------->GATA12 <---------MYB46(3)
                   <---------ANAC58                                    <---------GATA12<---------ANAC46
                   <---------ANAC58                                    --------->ARR11(2)
                  <---------MYB46(3)          --------->LBD16          <---------ARR14(2)
               <---------ANAC58              ------->GAMYB             <---------ARR11(2)
               <---------ANAC46        --------->At4g35610  <---------MYB46(3)  <---------At4g35610
               <---------ANAC58        <---------At4g35610  <------MYB46(1)     <---------ZAT2   ---
           --------->ZAT18           <-----------RAV1(2)    <---------DEAR3(2)<---------DEAR3(1) <--
          --------->ALFIN1    <---------O2--------->MYB52(1)<------MYB83<------ZmHOX2a(2)       ----
          <---------KAN1  --------->KAN1 --------->KAN1   <---------MYB52(1)--------->ARR11(2)  <---
    --------->LBD16<---------ANAC46<---------ANAC46  --------->TOE2(3) --------->ARR14(2)<-------GAMYB
 
tgctctccgaagagtgtgccttgggtgaggtactcgtggctcagataaccggctaacatcagttggttcgagccgatcggctcggctgctgcggttgaag  1028700
                                                 ----------->GT1
                                          <---------DEAR3(1)
                                          <---------ANAC46
                                         <---------ABI4(1)
                                         <---------At4g35610
                                         <------NtERF2
                                         <---------LBD16
                                         --------->At4g35610
                                         --------->ATERF1(1)
                                        <---------ERF1
                                        <---------RAP2.3(1)
                                        <---------DEAR4(2)
                                        <---------ORA47(2)                <---------KAN1
                                        <---------ATERF1(1)              <---------KAN1
                                        <---------RRTF1(1)              <---------GLK1(2)
                                        ------>NtERF2                  <------NtERF2
                          <------ZmHOX2a(1) <------NtERF2            <---------ANAC46
                       <------NtERF2    <---------RAP2.6(1)         <---------LBD16
                     <---------ANAC46  <---------DREB2C(2)         ------>NtERF2
                     <---------DEAR3(1)<---------RRTF1(2)          --------->LBD16
<---------ANAC58    <---------LBD16    <---------RRTF1(3)         <---------RAP2.6(2)       <-------
<---------ANAC58  ------->GAMYB        <---------RAP2.3(2)        <---------LBD16         --------->At4g35610
<---------ANAC46 <---------LBD16       <---------RAP2.3(3)        <---------RAP2.3(2)   <------ZmHOX2a(1)
------>GLK1(1)   --------->MYB46(3)    <---------DEAR3(1)        <---------LBD16   <---------ANAC46
-------GLK1(1)   --------->DEAR3(2)    <---------ATERF1(2)    <---------GLK1(1) ----------->HVH21
----->ARR11(3) <-----------GT1         <---------RAP2.6(2)    <----------DOF2   ----------->TGA1  <-
------ARR11(3)<---------KAN1           --------->ATERF1(2)    --------->GLK1(1)<-----------HVH21  <-
 
atttcttggaaatgggattaaccggcggaggaacaagtttaggcggcggagagggaaacttggcgatttccggcggattatcggtgacggaggagatgaa  1028800
                                                                                                   <
                                                                                                   <
                                                                                                   -
                                                                                                 <--
                                                                                                ----
                                                                                               <----
                        <-------GAMYB                                                          <----
                     ------>NtERF2                                                            <-----
                     --------->LBD16<---------ANAC58                                          ------
                    --------->ANAC46<---------bZIP60(2)                                       ------
                   <---------LBD16  --------->TGA1a                                           ------
                   --------->MYB46(3) --------->ALFIN1                                        ------
                 --------->ARR11(2) <---------O2                                              <-----
                 <---------ARR14(2) --------->O2--------->ANAC58                              <-----
                 --------->RVE1(2)  <---------ANAC58                                          ------
                 --------->ARR14(2) <---------TGA1a                                           ------
                 <---------ARR11(2) <---------ANAC46                                          ------
        ======================================bZIP_DOF                                        <<<<<<
        <----------DOF2 ======================MYC_MYB                                    --------->ANAC46
       --------->MYB52(2)<---------MYB52(1)  --------->DOF5.7(1)                         --------->ANAC58
<------NtERF2   <---------KAN1   ----------->HVH21 ------->TEIL                        <---------ANAC58
--REM1(1)       --------->KAN1 --------->ANAC58 --------->ANAC58         --------->KAN1<---------ANAC58
--------ANAC58 ===============================bZIP_DOF    <---------AtMYB61           <-------TEIL -
--------ANAC58 <----------DOF2 --------->ANAC58 --------->ANAC46        <---------RVE1(2)--------->ANAC58
 
ggcgtctcgttctttgcgcttatccgccgttagaacgcgacgtgggggaagacgcatcgttttggtgttcatggtgatactctattggatgcatgccacg  1028900
            <---------AHL25(3)
            <---------AHL20(2)
            <---------AHL25(2)
            --------->AHL25(2)
            <---------AHL12(3)
           --------->AHL25(2)
           <---------AHL20(3)
           <---------AHL25(1)
           --------->AHL20(3)
           --------->AHL12(3)
           --------->AHL20(2)
        --------->YAB5
        --------->YAB1
   --------->MYB46(3)
  --------->ANAC58
  --------->ANAC46
  --------->ANAC58
<---------ALFIN1
---------At4g35610
---------ZAT2
-------->ZAT2
---------bZIP910(2)
----->TGA2(2)                                                                            <---------ARR11(3)
-------HVH21<---------AHL25(1)                                                   <---------AHL20(2)
-------TGA1<---------AHL20(1)                                       ----------->GT1      <---------RVE1(2)
----TGA1a  <---------AHL20(2)                             <---------ANAC46       <---------AHL25(3)
--->TGA1a<---------AHL12(2)                         <---------AHL12(1)           --------->AHL20(2)
--->bZIP60(1)                                       --------->AHL12(1)          <---------AHL12(2)
--->O2 <---------ATHB51                             <---------AHL20(2)          --------->AHL12(3)
--->ANAC58 --------->AHL25(1)                      --------->AHL20(3)           <---------AHL12(3)
----O2 <---------ATHB12                            <---------AHL20(3)           --------->AHL25(2)
----bZIP60(1)                                      --------->AHL25(2)      --------->YAB1<---------GLK1(2)
--->ANAC58 <---------AHL25(3)                      <---------AHL25(2)    XXXXXXXXXXXXXXXXXXXX>MIR1888
--->bZIP60(2)   ----------->GT1              --------->RVE1(2)    --------->DOF5.7(1)    --------->ARR11(3)
--->ANAC46 <---------AHL25(2)          ----------->GT1    ----------->GT1--------->RVE1(2)
<<<<AtbZIP1--------->AHL25(3)  ----------->GT1<---------ATHB12   --------->DOF5.7(1)   <---------YAB5
-------->At4g35610             <---------ANAC46--------->YAB1   ---------->DOF2--------->AHL12(2)
 
tcagcacccaataataaaattgaaatattgactgtcgtaaaacagtcaaatcaaaataatcgggtgaaaaagagaaaatcaaaatttataaagattttgt  1029000
             xxxxxxxxxxxxxxxxxxxx>smallRNA(se3)
           <---------ANAC58
           <---------RAP2.6(2)
           <---------ANAC58
       --------->WOX13(2)                                                                     ------
       <---------WOX13(2)                                                                    -------
     <---------AHL20(2)   --------->DOF5.7(1)                                              ---------
     <---------YAB1<---------KAN1               <---------AHL12(2)                     --------->DOF5.7(1)
<----------DOF2<---------MYB59     --------->GLK1(2)     --------->DOF5.7(1)         <---------KAN1
 
tttcttttttaattgcgaccgaataacttaagagggagagtctgttttaaaaaaaaacttaagagggagagatagcgagagagagagaataagagaaaga  1029100
                                                                                 <---------AHL12(3)
                                                                                 <---------AHL20(2)
                                                                                 --------->AHL12(3)
                                                                                 --------->AHL20(2)
                                                                                 <---------AHL20(3)
                                                                                 <---------AHL25(3)
                                                                                 --------->AHL25(2)
                                                                                 --------->AHL25(1)
                                                                                 --------->AHL20(3)
                                                                                <---------AHL25(2)
                                                                                <---------AHL25(1)
                                                                                --------->AHL25(1)
                                                                                --------->AHL20(3)
                                  ------------>CBF                              --------->AHL25(2)
                             <---------ARR11(2)                <---------At5g28300
                             --------->ARR11(2)               <-----------GT1   --------->AHL20(2)
                           <------MYB83<---------AHL20(2)   --------->WOX13(2)  <---------AHL20(2)
                           <------MYB46(1)                  <---------WOX13(2)  --------->AHL25(3) <
                          --------->MYB111(1)              --------->WOX13(2)   --------->YAB1     -
  --------->MYB52(1)      --------->MYB59                --------->AHL25(1)     <---------AHL20(1)--
 <---------KAN1  *TSS     --------->MYB46(2)             --------->AHL20(2)------------>CBF       --
--->DOF5.7(1)  <---------TOE2(3)--------->ANAC58      ----------->GT1   <---------DAG2     ---------
-->DOF5.7(1)   <---------TOE1(3)--------->ANAC58 --------->ALFIN1 --------->ANAC46<---------AHL12(2)
->DOF2 ---------->DOF2   <--------P   <-----------TBP----------->GT1    <----------DOF2 --------->TOE2(3)
 
ggggataacagaaagtttaagggaatgggtaggttacgacaatttatagaggctggaggtttaaattaccctctacttttcaataaaattacattaatgc  1029200
                                                                               --------->YAB5
                                                                              <---------YAB1
                                                                           <---------AHL25(3)
                                                                           <---------AHL20(2)
                                                                          <---------AHL20(3)
                                                                         --------->AHL12(2)
                                                                         <---------AHL12(2)
                                                                        <---------AHL12(3)
                                                                        <---------AHL20(3)
                                        --------->ARR11(2)              --------->AHL12(3)
                                        --------->ARR14(2)              --------->AHL20(3)
                                        <---------ARR14(2)              <---------AHL20(2)
                                       <---------MYB52(1)              <---------AHL25(3)
           <-----------GT1         <---------At5g28300                 --------->AHL25(3)
  <---------WOX13(2)            <----------DOF2                       <---------AHL25(1)
  <------------CBF              <---------DAG2                        --------->AHL20(2)
  --------->WOX13(2)           <---------ANAC58                       --------->AHL25(1)
---------ATHB12                <---------ANAC58                       <---------AHL12(3)
----------->CBF            <----------DOF2                            --------->AHL12(3)         ---
------->ANAC58            <---------DOF5.7(1)                         <---------AHL20(2)      <-----
------->ANAC58   <------------CBF <-----------GT1                     --------->AHL25(3)     <------
->DOF2   <---------KAN1 ------>ZmHOX2a(1)                       --------->AHL20(2)    --------------
 
cactcaattggaatttactggattgtccttctttgctttaccgtttcttcaattttgggttacccattgaaatataaatttatgactaaattgttccttt  1029300
                                               <---------TOE2(3)
                                               <---------WOX13(2)
                                             <---------AHL20(2)
                                             <---------AHL25(3)
                                            --------->AHL20(2)
                                            --------->AHL20(1)
                                            <---------AHL20(2)
                                            --------->AHL25(3)                                     <
                                            <---------AHL25(3)                                   <--
                                            --------->AHL25(2)                                  <---
                                            <---------AHL20(3)                                 -----
       ---------->DOF2                      <---------AHL25(2)                                 -----
   --------->YAB1                           <---------AHL25(1)                                 <----
  <---------YAB1                            --------->AHL25(1)                                 <----
  <---------------AGL15                    --------->AHL12(2)          --------->DAG2          -----
------>KAN1                      --------->ANAC46             <----------DOF2                  -----
----DOF5.7(1)     --------->DAG2 --------->ANAC58         <---------ANAC58                     <----
----DOF2         ---------->DOF2 --------->ANAC58         <---------ANAC58                    ------
->AtSPL8    ----------->GT1   <---------REM1(2)--------->WOX13(2)     ---------->DOF2    <----------
 
ttattctcataaaagttgtataaagttggagactacaaggaatcaaatttaatgaaattttgcttctttggcataaagtttttatgagtttgtgcgaaat  1029400
         --------->HSFB2a(1)
         <---------HSFC1(2)
         --------->HSFC1(2)
 <---------TOE2(3)
---------->DOF2
---------AHL20(2)
-------AHL12(2)
------AHL25(3)
---->AHL25(1)
---->ICU4<---------HSFB2a(1)
-----AHL12(1)                  --------->DAG2
-----AHL25(1)                 ---------->DOF2
---->AHL12(1)             ------>ZmHOX2a(1)
---->AHL20(2)         --------->ARR11(2)
-----AHL12(3)         <---------ARR14(2)            ----------->GT1
--->AHL25(3)<---------LBD16--------->TOE1(1)  <---------ICU4                      ------->TEIL
-----------WRI1       --------->ARR14(2)  <-------TEIL  <---------CCA1(2)       --------->YAB5    --
 
atttaaagtagaagcttcggaatccaatcctcgtaaagtcatacatacataagtactgtatatcatatactttctactaaaaatgaatctcttaaaaaac  1029500
                                                                         <---------ANAC58
                                                                   <---------------AtSPL3
                                                                   --------------->AtSPL8
                                                                   <---------------AtSPL8
                                                              --------->ICU4        --------->YAB1
                                                              <---------YAB1       <---------YAB1
        <---------KAN1                                        <---------YAB5    <---------YAB1
       --------->GLK1(2)                                    <---------ICU4    --------->ZAT6
       ------->TEIL                                         --------->YAB1    --------->YAB5
      <---------GLK1(2)                                     --------->YAB5  --------->RVE1(2)
      <---------ARR14(1)                                   <---------ATHB12<---------CCA1(2)
  --------->MYB52(1)                                       <---------YAB5<---------ANAC58        <--
--------->DOF5.7(1)                                  <---------ANAC46 <-----------GT1 <---------YAB1
-------->DOF2                      <---------GATA12  <---------ANAC55(2) <---------ANAC46  ---------
 
aaaaagaacgaatctcttattttcatgtttaggctagacatctaagtttatatgttatgtgaatcatgattttgtaccgtatcactattataaatcatat  1029600
<- Previous    Next ->

AGI:  At1g04000.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G44060.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO40594.1); contains InterPro domain Ankyrin (InterPro:IPR002110)
Range:  from: 1028105    to: 1029118    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version