AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                   --------->TOE2(3)
                                                                                   --------->YAB1
                  --------->ATHB12                                                 ------->GAMYB
                  --------->YAB5                                                  --------->MYB46(3)
                  <---------ICU4                                                 -------->P
      <---------ICU4                                                            --------->WOX13(1)
 --------->ARR11(3)    --------->At4g35610          <----------DOF2           <------ZmHOX2a(2)
 <---------ARR11(3)--------->TOE2(3)             --------->ANAC58            --------->RVE1(2)
--ZmHOX2a(1)     <---------YAB1                  --------->ANAC58            --------->AGP1
----->GT1     ------>MYB46(1)                --------->ANAC58         <---------KAN1
>DOF5.7(1)    ------>MYB83                   --------->ANAC58        <---------KAN4(2)             -
--AGL15      ----------->RAV1(1)             --------->ANAC46 --------->KAN1 <---------GATA12   ----
->AGL15    --------->MYB46(3)         ----------->RAV1(1) --------->AtLEC2   --------->GATA12   ====
 
ataatatcatcttcaccaacatcattagctcaagtttcagacaacaaaacgcaagctttctatgcaaatgcgaataaacagatcaaccaaaatttgcctc  13346300
                                                                 <---------AHL20(2)
                                                                 <---------AHL25(1)
                                                                 --------->YAB1
             --------->YAB1     --------->AtLEC2                 --------->AHL20(2)
 --------->DOF5.7(1)          --------------->AGL15            --------->WOX13(2)
--------->DOF2  <---------GLK1(1)  ---------->DOF2             <---------WOX13(2)
----------->AGL15          --------->RVE1(2)         <---------YAB1
==============================================MADS_MADS    ----------->GT1
 
tataaagagataacaatagaaatcagggctaatccatgaaaagaaaactctcaattctcatggagtaattaaaacaaaacaaatacaaaaacaaaccttg  13346400
                                                       ------>ZmHOX2a(2)
                                                      <------ZmHOX2a(2)
                                                      --------->GLK1(1)
                                                      <---------GLK1(1)
                                                     <---------ARR11(3)
                    <---------HSFB2a(2)              --------->ARR14(2)
                  --------->CCA1(2)                  --------->ARR11(3)
                  <------ZmHOX2a(2)                  <---------ARR14(2)
                  =================================HOX2a_HOX2a
                  ==============================HOX2a_HOX2a
                 <---------ARR11(2)                  <---------AGP1
                 --------->ARR11(2)                  <---------RVE1(2)
                 <---------ARR14(2)                  <---------GATA12
                 <---------ARR11(3)            <----------DOF2
                 --------->AGP1             =================HOX2a_HOX2a
                 --------->GATA12         <---------DOF5.7(1)
                 --------->ARR14(2)      ====================HOX2a_HOX2a                ---------->ID1
                 --------->ARR11(3)      =====================HOX2a_HOX2a         <---------AHL20(2)
                 <---------GATA12        ------>ZmHOX2a(1)  --------->ANAC46     --------->AHL25(3)
                --------->GLK1(1) <---------ARR11(3) --------->GATA12            <---------AHL20(2)
                <---------GLK1(1) --------->ARR11(3)<---------CCA1(2)        <---------DOF5.7(1)
         <---------DAG2     --------->ANAC58==================HOX2a_HOX2a    <---------DAG2      ---
         <----------DOF2    --------->ANAC58------>ZmHOX2a(1)                <----------DOF2     <--
 
taaatgttcttacttttggagatccagagggaagaaatgtcttcctccttcttttagatctccacgaagataaatgagagcttttttatttgtcttcttc  13346500
                                                                                                   -
                                                                                                   -
             ------------------------>ANAC81                                                       -
        <---------MYB46(3)                                               <---------KAN1           <-
       <---------ANAC46               ---------->DOF2              --------->DAG2            -------
       --------->ALFIN1           <------ZmHOX2a(1)                --------->DOF5.7(1)       -------
 <---------ARR11(2)          <---------KAN1                       --------->DAG2            <-------
 <---------ARR14(2)       <------ZmHOX2a(1)                       --------->DOF5.7(1)   --------->At4g35610
 --------->ARR14(2)   --------->DOF5.7(1)                        --------->DOF5.7(1)    <---------At4g35610
------>At4g35610     --------->DOF5.7(1)--------->DOF5.7(1)      ---------->DOF2      --------->ZAT18
-------At4g35610    ---------->DOF2  <------ZmHOX2a(1)    ------------------------>ANAC81 --------->DEAR3(1)
 
tgcagaaatggtgggagacgaagaaaagaggaatgaaggaggaaaggaagacgaagatgaagacgaagaaaagggaatgtaatgtatagttcgcagaccc  13346600
                                       --------->LBD16
     *TSS                            <---------LBD16
  ---------->DOF2             ---------->DOF2  --------->TOE2(3)
-------->YAB1  --------->RAP2.6(2)   <------NtERF2
-------->TOE1(3)           <-----------TBP  <---------CCA1(2)                                     --
-------->TOE2(3)--------->LBD16      --------->ATERF1(1)         ------>MYB46(1)                  <-
--------ATHB12 --------->ANAC46     --------->ZAT2<-----------GT1------>MYB83       <---------WOX13(2)
-->ANAC58      ------->GAMYB <---------AHL20(2)--------->YAB1 *TSS      --------->WOX13(2)    ------
-->ANAC58     --------->MYB46(3)   <---------ARR14(2)    --------->AHL20(2)         --------->WOX13(2)
--GATA12     <---------At5g28300--------->DOF5.7(1) <---------YAB5      <---------WOX13(2)    <-----
 
aatcttaaagcccattaaccgcaaactgatatataaaggagccgggtctatcttaaccatttaaaaccaacttctaatttggaatcaaattgaaccgaat  13346700
                                                                                         --------->DOF5.7(2)
                                                                                        <-----------HVH21
                                                                                        <----------DOF2
                                                                                     --------->LBD16
                                                                                    --------->DEAR3(1)
                                                                                    ------->GAMYB --
                                                                                   --------->DEAR3(2)
                                                                                   <------------AtMYB77
                                                      --------->GATA12             --------->MYB46(3)
                             <---------ANAC58         --------->RVE1(2)           --------->MYB52(1)
                          --------->DOF5.7(1)         --------->ARR14(2)      --------->ANAC46   ---
                          --------->DAG2         ----------->GT1              --------->ANAC58   ---
                         --------->DOF5.7(1)    --------->DOF5.7(1)     --------->ARR14(2)       ---
                        --------->DOF5.7(1)<---------HSFB2a(2)  <----------CDC5   -------->P    <---
------->ARR11(2)        ---------->DOF2--------->LBD16<---------GATA12  <---------ARR11(2) <--------
--------ARR11(2)    <------ZmHOX2a(1) <---------ANAC58<---------ARR11(2)<---------ARR14(2)<---------ARR11(2)
--->RVE1(2)        ----------->GT1    <---------ANAC58<---------ARR14(2)--------->ARR11(2)--------->ARR11(2)
------ARR10  ---------->DOF2 <---------ANAC58 ---------->DOF2  --------->YAB5 --------->ANAC58  <---
 
cgaaccggttgaagttgaaagaaggagaaaaggcgttgtctccgtgcgagaaaggcaaatcggagacgatgagcgaaaccgaagcaaccggcgttaccga  13346800
     ------>NtERF2                                            ----------->GT1
   --------->At4g35610                                        <---------MYB46(3)
   <---------At4g35610                                       --------->ALFIN1
------->ARR11(1)                                             <---------YAB5                  -------
------>ATHB12                                                <---------AtMYB61               <------
------>KAN1                                             ------>ZmHOX2a(2)                  <------ZmHOX2a(1)
------>YAB5                                            <------ZmHOX2a(2)       <------ZmHOX2a(1)
------YAB1                                             ===============================HOX2a_HOX2a
-DOF5.7(2)                              --------->ALFIN1==============================HOX2a_HOX2a
------ATHB12                     <---------At4g35610  <---------GATA12        --------->DOF5.7(1)
 
tgattcggctccagcgattgagactgaaactgtttctgatgcgatggagcatacagcgatcggagtggttgaatcggtggaaggagccatagaaggagca  13346900
                     ------->GAMYB
           --------->ATHB12
        <------MYB46(1)--------->SPL7(1)
        <------MYB83 <---------SPL7(1)
        <---------ANAC58
        <---------ANAC58<---------DEAR3(1)
        ----------->GT1<---------ORA47(1)
       --------->MYB111(2)
       <---------MYB46(3)
       <---------DEAR3(1)                            <---------ANAC58
       --------->MYB55(2) --------->At5g28300        <---------ANAC58
      --------->ALFIN1--------->MYB52(1)  --------->ARR11(2)
    <---------ANAC58 ----------->HVH21    --------->ARR14(2)                                <-------
    <---------ANAC58<---------MYB52(2)    <---------ARR11(2)                 --------->KAN1 --------
--------->CCA1(2)   --------->MYB46(3)    <---------ARR14(2)            --------->LBD16     --------
-->At4g35610       <---------At4g35610   <------ZmHOX2a(1)             <---------ANAC46     <-------
---At4g35610<---------RVE1(2)          <---------TOE1(2)   <---------At4g35610    <-----------GT1
 
gagaaatgggtgggtgatttgcaacggacggtgaaggaatcgaaggataccgcaatgcgttctgctcgttccctccgtgaaaattctacctctcagttcc  13347000
                                                <---------ARR14(2)
                                                --------->ARR14(2)
                                                --------->GLK1(2)
                                                --------->ARR11(2)                             -----
           --------->WOX13(2)                <---------ANAC58                                 <-----
        <--------P                ------>MYB83  <---------ARR11(2)                            ------
 --------->ZAT14      <----------DOF2        <---------ANAC58                                 <-----
 <---------ZAT14     <---------DOF5.7(1)<---------ICU4                                        ------
--ARR11(2) <---------WOX13(2)     ------>MYB46(1)                                --------->GLK1(1)
->ARR14(2)----------->GT1       --------->MYB46(3)                               <---------GLK1(1)
->ARR11(2)--------->MYB46(2)    <---------MYB46(2)                             <------ZmHOX2a(1) <--
--ARR14(2)--------->MYB52(2)   --------->ANAC46 <---------GATA12            <---------LBD16   <-----
 
gctctatacaggttagttaatctctcttttgttcaccaaacaatttttgcgaatcgagattgtttaccaaaaaacattttcaggatttcaaaccatggat  13347100
                                                                   <---------WOX13(2)
                               --------->HSFB2a(2)                 --------->WOX13(2)
---->CCA1(2)                   --------->HSFC1(1)              --------------->AGL15
----ARR14(2)                   <---------HSFC1(1)        <---------CCA1(1)
--->ARR14(2)            <---------YAB1                   <---------RVE1(1)
----ARR11(2)       --------->ANAC58                     <---------RVE1(2)
--->ARR11(2)       --------->ANAC58                     <---------ARR11(3)
-------AtMYB61 <---------ANAC55(2)      --------->At4g35610    <---------------AGL15  --------->ATHB12
----RVE1(2)--------->ARR11(3)  <---------HSFB2a(2)      --------->ARR11(3)      --------->ANAC55(2)
 
atggtggaatttagtatctcgtaagctataatttctagaaatgagctcgattcagaacagatatttctccaattagcagttttatgtattgaatggtgct  13347200
<- Previous    Next ->

AGI:  At4g26400.1   
Description:  zinc finger (C3HC4-type RING finger) family protein. similar to zinc finger (C3HC4-type RING finger) family protein [Arabidopsis thaliana] (TAIR:AT5G56340.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO22124.1); contains InterPro domain Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); contains InterPro domain Zinc finger, RING-type; (InterPro:IPR001841)
Range:  from: 13344817    to: 13346606    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At4g26410.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G45060.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO22126.1); contains InterPro domain Uncharacterised conserved protein UCP022280 (InterPro:IPR016803)
Range:  from: 13346663    to: 13349025    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version