AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                           --------->DOF5.7(1)
                                                    <---------------AGL15
                                                   =================================================
                                                   ------>ZmHOX2a(2)
                                                  <------ZmHOX2a(2)
                                                 --------->AGP1
                                                 --------->ARR14(2)
                                                 <---------AGP1
                                                 <---------ARR11(3)
                                                 <---------ARR11(2)
                                                 --------->ARR11(2)
                                                 <---------ARR14(2)
                                                 --------->RVE1(2)                             <----
                                                 <---------GATA12                             ------
                                                 --------->GATA12                        ---------->DOF2
                                                 --------->ARR11(3)                      --------->DOF5.7(1)
                                                <---------CCA1(2)                     --------------
<---------AHL12(2)      ---------->DOF2      <---------At4g35610                      <-------------
-->RAV1(1)   --------->ANAC58       <----------DOF2----------------->AGL3          --------->ZAT6
-ID1         --------->ANAC58      <---------DOF5.7(1)   ---------->DOF2    ---------->DOF2---------
 
aaaaaaaaacatgaagaagcaaacctataaagtttcgacctttgtttcatcagatctaaataaagagaatggtattcccaaaagtttcactaaaaagagg  13346200
                                                                                   --------->TOE2(3)
                                                                                   --------->YAB1
                  --------->ATHB12                                                 ------->GAMYB
                  <---------ICU4                                                  --------->MYB46(3)
      <---------ICU4                                                             -------->P
 <---------ARR11(3)    --------->At4g35610                                      --------->WOX13(1)
 --------->ARR11(3)--------->TOE2(3)                <----------DOF2           <------ZmHOX2a(2)
==MADS_MADS       --------->YAB5                 --------->ANAC58            <---------GATA12
--ZmHOX2a(1)     <---------YAB1                  --------->ANAC58            --------->RVE1(2)
----->GT1     ------>MYB46(1)                --------->ANAC58         <---------KAN1
->AGL15       ------>MYB83                   --------->ANAC46        <---------KAN4(2)             -
--AGL15      ----------->RAV1(1)             --------->ANAC58 --------->KAN1 --------->GATA12   ====
>DOF5.7(1) --------->MYB46(3)         ----------->RAV1(1) --------->AtLEC2   --------->AGP1     ----
 
ataatatcatcttcaccaacatcattagctcaagtttcagacaacaaaacgcaagctttctatgcaaatgcgaataaacagatcaaccaaaatttgcctc  13346300
                                                                 <---------AHL25(1)
                                                                 --------->AHL20(2)
                                                                 --------->YAB1
             --------->YAB1     --------->AtLEC2                 <---------AHL20(2)
 --------->DOF5.7(1)          --------------->AGL15            <---------WOX13(2)
--------->DOF2  <---------GLK1(1)  ---------->DOF2             --------->WOX13(2)
==============================================MADS_MADS    ----------->GT1
----------->AGL15          --------->RVE1(2)         <---------YAB1
 
tataaagagataacaatagaaatcagggctaatccatgaaaagaaaactctcaattctcatggagtaattaaaacaaaacaaatacaaaaacaaaccttg  13346400
                                                       ------>ZmHOX2a(2)
                                                      --------->GLK1(1)
                                                      <---------GLK1(1)
                                                      <------ZmHOX2a(2)
                                                     <---------GATA12
                    <---------HSFB2a(2)              --------->GATA12
                  =================================HOX2a_HOX2a
                  <------ZmHOX2a(2)                  <---------ARR14(2)
                  --------->CCA1(2)                  <---------RVE1(2)
                  ==============================HOX2a_HOX2a
                 <---------ARR11(3)                  <---------AGP1
                 <---------ARR14(2)                  --------->ARR11(3)
                 <---------GATA12                    <---------ARR11(3)
                 <---------ARR11(2)            <----------DOF2
                 --------->ARR11(2)         =================HOX2a_HOX2a
                 --------->ARR14(2)       <---------DOF5.7(1)
                 --------->GATA12        =====================HOX2a_HOX2a               ---------->ID1
                 --------->ARR11(3)      ------>ZmHOX2a(1)  --------->ANAC46      <---------AHL20(2)
                 --------->AGP1          ====================HOX2a_HOX2a         <---------AHL20(2)
                --------->GLK1(1) <---------ARR11(3) --------->ARR14(2)          --------->AHL25(3)
                <---------GLK1(1) --------->ARR11(3)<---------CCA1(2)        <----------DOF2
         <----------DOF2    --------->ANAC58==================HOX2a_HOX2a    <---------DAG2      <--
         <---------DAG2     --------->ANAC58------>ZmHOX2a(1)                <---------DOF5.7(1) ---
 
taaatgttcttacttttggagatccagagggaagaaatgtcttcctccttcttttagatctccacgaagataaatgagagcttttttatttgtcttcttc  13346500
                                                                                                   -
                                                                                                   -
             ------------------------>ANAC81                                                       -
        <---------MYB46(3)                                               <---------KAN1           <-
       --------->ALFIN1               ---------->DOF2              --------->DAG2            -------
       <---------ANAC46           <------ZmHOX2a(1)                --------->DOF5.7(1)       -------
 <---------ARR14(2)          <---------KAN1                       --------->DAG2            <-------
 --------->ARR14(2)       <------ZmHOX2a(1)                       --------->DOF5.7(1)   --------->At4g35610
 <---------ARR11(2)   --------->DOF5.7(1)                        ---------->DOF2        <---------At4g35610
-------At4g35610     --------->DOF5.7(1)--------->DOF5.7(1)      --------->DOF5.7(1)  --------->ZAT18
------>At4g35610    ---------->DOF2  <------ZmHOX2a(1)    ------------------------>ANAC81 --------->DEAR3(1)
 
tgcagaaatggtgggagacgaagaaaagaggaatgaaggaggaaaggaagacgaagatgaagacgaagaaaagggaatgtaatgtatagttcgcagaccc  13346600
                                       --------->LBD16
     *TSS                            <------NtERF2
  ---------->DOF2             ---------->DOF2  --------->YAB1
-------->YAB1  --------->ANAC46      --------->ATERF1(1)
-------->TOE2(3)           <-----------TBP  <---------CCA1(2)                                     <-
-------->TOE1(3)--------->LBD16      <---------LBD16          *TSS      --------->WOX13(2)        --
--------ATHB12 ------->GAMYB <---------AHL20(2)--------->TOE2(3) ------>MYB83                 ------
-->ANAC58      --------->RAP2.6(2)  --------->ZAT2<-----------GT1------>MYB46(1)    <---------WOX13(2)
-->ANAC58     --------->MYB46(3)   <---------ARR14(2)    --------->AHL20(2)         --------->WOX13(2)
--GATA12     <---------At5g28300--------->DOF5.7(1) <---------YAB5      <---------WOX13(2)    <-----
 
aatcttaaagcccattaaccgcaaactgatatataaaggagccgggtctatcttaaccatttaaaaccaacttctaatttggaatcaaattgaaccgaat  13346700
                                                                                         --------->DOF5.7(2)
                                                                                        <-----------HVH21
                                                                                        <----------DOF2
                                                                                     --------->LBD16
                                                                                    --------->DEAR3(1)
                                                                                    ------->GAMYB --
                                                                                   --------->DEAR3(2)
                                                                                   --------->MYB46(3)
                                                      --------->ARR14(2)           <------------AtMYB77
                             <---------ANAC58         --------->GATA12            --------->MYB52(1)
                          --------->DOF5.7(1)         <---------ARR14(2)      --------->ANAC58   ---
                          --------->DAG2         ----------->GT1              --------->ANAC46   ---
                         --------->DOF5.7(1)    --------->DOF5.7(1)     --------->ARR14(2)       ---
                        ---------->DOF2--------->LBD16--------->RVE1(2) --------->ARR11(2) <--------
--------ARR11(2)        --------->DOF5.7(1)<---------HSFB2a(2)  <----------CDC5   -------->P    <---
------->ARR11(2)    <------ZmHOX2a(1) <---------ANAC58<---------ARR11(2)<---------ARR11(2)--------->ARR11(2)
--->RVE1(2)        ----------->GT1    <---------ANAC58<---------GATA12  <---------ARR14(2)<---------ARR11(2)
------ARR10  ---------->DOF2 <---------ANAC58 ---------->DOF2  --------->YAB5 --------->ANAC58  <---
 
cgaaccggttgaagttgaaagaaggagaaaaggcgttgtctccgtgcgagaaaggcaaatcggagacgatgagcgaaaccgaagcaaccggcgttaccga  13346800
     ------>NtERF2                                            <---------MYB46(3)
   <---------At4g35610                                        ----------->GT1
   --------->At4g35610                                       <---------AtMYB61
------->ARR11(1)                                             <---------YAB5                  <------
------>YAB5                                                  --------->ALFIN1                -------
------>ATHB12                                           ------>ZmHOX2a(2)                  <------ZmHOX2a(1)
------>KAN1                                            ===============================HOX2a_HOX2a
-DOF5.7(2)                                             <------ZmHOX2a(2)       <------ZmHOX2a(1)
------ATHB12                            --------->ALFIN1==============================HOX2a_HOX2a
------YAB1                       <---------At4g35610  <---------GATA12        --------->DOF5.7(1)
 
tgattcggctccagcgattgagactgaaactgtttctgatgcgatggagcatacagcgatcggagtggttgaatcggtggaaggagccatagaaggagca  13346900
                     ----------->HVH21
           --------->ATHB12
        <------MYB83 ------->GAMYB
        <------MYB46(1)<---------ORA47(1)
        ----------->GT1--------->SPL7(1)
        <---------ANAC58
        <---------ANAC58<---------DEAR3(1)
       <---------MYB46(3)
       --------->MYB55(2)
       --------->MYB111(2)                           <---------ANAC58
       <---------DEAR3(1) --------->At5g28300        <---------ANAC58
      --------->ALFIN1--------->MYB52(1)  <---------ARR11(2)
    <---------ANAC58 <---------SPL7(1)    --------->ARR14(2)                                --------
    <---------ANAC58<---------MYB52(2)    --------->ARR11(2)                 --------->KAN1 <-------
--------->CCA1(2)   --------->MYB46(3)    <---------ARR14(2)            --------->LBD16     <-------
---At4g35610       <---------At4g35610   <------ZmHOX2a(1)             <---------ANAC46     --------
-->At4g35610<---------RVE1(2)          <---------TOE1(2)   <---------At4g35610    <-----------GT1
 
gagaaatgggtgggtgatttgcaacggacggtgaaggaatcgaaggataccgcaatgcgttctgctcgttccctccgtgaaaattctacctctcagttcc  13347000
                                                <---------ARR11(2)
                                                --------->GLK1(2)
                                                --------->ARR11(2)
                                                <---------ARR14(2)                             -----
           <---------WOX13(2)                <---------ANAC58                                 ------
        <--------P                ------>MYB46(1)                                             <-----
 --------->ZAT14      <----------DOF2        <---------ANAC58                                 <-----
 <---------ZAT14     <---------DOF5.7(1)<---------ICU4                                        ------
->ARR14(2) --------->WOX13(2)     ------>MYB83  --------->ARR14(2)               --------->GLK1(1)
--ARR11(2)--------->MYB46(2)    --------->MYB46(3)                               <---------GLK1(1)
--ARR14(2)--------->MYB52(2)    <---------MYB46(2)                             <------ZmHOX2a(1) <--
->ARR11(2)----------->GT1      --------->ANAC46 <---------GATA12            <---------LBD16   <-----
 
gctctatacaggttagttaatctctcttttgttcaccaaacaatttttgcgaatcgagattgtttaccaaaaaacattttcaggatttcaaaccatggat  13347100
<- Previous    Next ->

AGI:  At4g26400.1   
Description:  zinc finger (C3HC4-type RING finger) family protein. similar to zinc finger (C3HC4-type RING finger) family protein [Arabidopsis thaliana] (TAIR:AT5G56340.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO22124.1); contains InterPro domain Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); contains InterPro domain Zinc finger, RING-type; (InterPro:IPR001841)
Range:  from: 13344817    to: 13346606    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At4g26410.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G45060.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO22126.1); contains InterPro domain Uncharacterised conserved protein UCP022280 (InterPro:IPR016803)
Range:  from: 13346663    to: 13349025    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version