AthaMap TU-Logo
Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                          --------->ARR11(2)   <---------AHL20(2)
              --------->ARR14(2)     --------->AHL12(3)
              --------->ARR11(2)     <---------AHL20(2)
              <---------ARR14(2)     --------->AHL20(2)
              <---------ARR11(2)     <---------AHL20(3)
              --------->GATA12       --------->AHL25(3)
              <---------GATA12       <---------AHL25(3)
    --------->AHL20(3)    --------->ARR14(2)  <---------YAB1                                   -----
    <---------AHL12(3)    --------->RVE1(2)<---------AHL25(2)                                -------
    <---------AHL20(3)    <---------ARR11(2) <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)            <------
    --------->AHL12(3)    <---------ARR14(2) --------->AHL12(2)                              <------
  <---------AHL12(1)     --------->GLK1(1) <---------AHL20(3)                                -------
  <---------AHL20(2)     <---------KAN1    --------->AHL25(2)                                <------
  --------->AHL12(1)     <----------TaMYB80--------->AHL25(1)                                <------
  --------->AHL12(3)     --------->KAN1    <---------AHL25(1)                                <------
  <---------AHL12(3)     <---------GLK1(1)--------->AHL20(2)                                 -------
 --------->AHL25(3)     --------->ARR14(2)--------->AHL25(2)                                 <------
 <---------AHL20(1)     --------->ARR11(2)<---------AHL25(2)                                 -------
 --------->AHL20(1)     ---------->TaMYB80--------->AHL12(3)                                 -------
<---------AHL12(3)      <---------ARR14(2)--------->AHL25(3)                      <---------DAG2
<---------AHL20(2)      <---------ARR11(2)<---------AHL12(3)                   <-----------GT1 <----
--------->AHL12(3)   <---------ANAC46--------->AHL25(1)                     <---------KAN1  --------
------->AHL20(2)    <---------At4g35610   --------->AHL25(1)           <---------TOE2(3)    --------
------->AHL12(3)------>ZmHOX2a(2)    <---------AHL25(1)--------->MYB52(2)--------->YAB5    <--------
---YAB5 <---------YAB1  <-----------ARR10 <---------AHL25(1)          <-----------GT1      ---------
>YAB1 --------->YAB1--------->At4g35610--------->AHL12(2)         <----------DOF2 <----------DOF2 <-
tatatatatttataatggatcggagcggatatccacctatttaaattttattatttgttatttgctctgcttttaacgaatattacttttcaatatttaa  13326500
                        --------->GATA12                                                    ------->TEIL
    xxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)                                                   <--------
 --------->TOE2(3)      <---------ARR14(2)                                               --------->ANAC58
---->WOX13(2)           <---------GLK1(2)                                            --------->ANAC58
-->AHL20(2)             --------->ARR14(2)                                  --------->AHL12(1)
---AHL25(3)             <---------ARR11(3)                                  <---------AHL20(3)
---AHL12(1)       <---------ARR11(2)                                        <---------AHL20(1)
-->AHL12(3)       <---------ARR14(2)                                        --------->AHL20(1)
---AHL12(3)       --------->ARR14(2)                                        --------->ARR11(3)
---AHL25(2)      --------->GLK1(1)                                          --------->AHL25(2)
---AHL25(1)      <---------GLK1(1)                                          <---------AHL12(1)
-->AHL25(1)      --------->KAN1                                            --------->AHL12(3)
---AHL20(2)      <---------KAN1                                            <---------AHL12(1)
-->AHL12(1)     <---------ARR11(2)                          --------->GATA12<---------AHL25(2)
-->AHL25(3)     --------->ARR11(2)                          <---------GATA12<---------AHL25(3)
-----WOX13(2)   --------->ARR14(2)                          --------->RVE1(2)        --------->ANAC58
->AHL20(2)      <---------ARR14(2)    --------->RVE1(2) <------ZmHOX2a(2)  --------->AHL25(1)  <----
->AHL25(3)   <---------ANAC55(2)      <---------GATA12 <---------GATA12    --------->AHL12(1) ------
-AHL12(2)   <---------LBD16 <-----------GT1      <---------KAN1    <---------MYB52(2)--------->AtLEC2
>AHL12(2)  --------->MYB52(1)         --------->GATA12 --------->RVE1(2)   --------->AHL25(3)<------
----------GT1<---------ANAC46    --------->RVE1(2)--------->MYB52(1) --------->MYB52(1)  --------->ANAC58
tttacctcatacacttacggatatccagatttttcgaatcaaatcgaaccgaataacggatcaaatcgaaactaacaaatattttgccaagcacgaatct  13326600
                                                         ------>ZmHOX2a(1)                 ---------
                                                   --------->YAB5                         <---------ETT(2)
                                                  <---------YAB1                         <------NtERF2
                                                  <---------YAB5                        ------>NtERF2
                                                -------->HAHB4                          <---------ATERF1(1)
                                                --------->YAB1                         ----------->HVH21
                                                <---------ICU4                         --------->At1g77200
                                               --------->ICU4                          --------->DEAR3(1)
   --------->HSFB2a(2)                        <---------WOX13(2)                      --------->RAP2.3(1)
   <---------HSFB2a(2)                        <---------AHL20(3)                      --------->DEAR3(2)
->ARR14(2)                                    --------->WOX13(2)                      --------->ATERF1(1)
--ARR14(2)                                    --------->AHL20(3)                      <------NtERF2
->GLK1(2)         ------>ZmHOX2a(1)          --------->YAB1                          <---------ATERF1(1)
--ARR11(1)        --------->LBD16            --------->YAB5                         <---------DEAR3(1)
-CCA1(2)        ----------->RAV1(2)          <--------HAHB4                   <---------WOX13(2)  --
------DOF2   <---------At4g35610            <---------AHL20(2)                --------->WOX13(2)  <-
--->YAB5<---------KAN1                      <---------YAB1                 ------>ZmHOX2a(1)    ----
---KAN1<-----------ARR10 <----------DOF2  --------------->AGL15           --------->TOE2(3)------>NtERF2
ttagttcgcgaatttaagctcctggttactttcttctagggttttctataattatgattcctctcgtctattctagtccttaattagtcgccgacgacaa  13326700
                                <---------MYB52(2)    --------->WOX13(1)
      <---------AHL12(2)       --------->ANAC46     <---------ATHB12                              <-
-->RAV1(1)                 --------->ANAC58<---------GLK1(1)                             <----------
--------->GT1              --------->ANAC58--------->GLK1(1)             <---------RVE1(2)    <-----
---------ID1    ---------->DOF2--------->ANAC58     ------------>CBF    --------->KAN1<----------DOF2
------>DOF2 --------->TOE1(2)  --------->ANAC58    --------->ANAC46   <------------------------ANAC81
aaagaaaaaaaaaaacctagaaagcttgacaaacaaggaacgacgcatatctccaaacaatcagtgtaatttctgtgattctctgtttccttttgttgtg  13326800
        <---------ARR11(2)                                                         <------ZmHOX2a(2)
        --------->ARR14(2)                                                        --------->RVE1(2)
        --------->ARR11(2)              <------MYB46(1)                         --------->LBD16
  <---------RVE1(2)                  <---------MYB52(1)                       <---------LBD16      -
 --------->KAN1       ------>ZmHOX2a(1) <------MYB83                    <---------WRKY38(1)        <
---------DOF2        --------->TOE2(3) <---------AtMYB61             --------->WOX13(1)            <
-RAV1(1)<---------RVE1(2)         <---------YAB5     ----------->HVH21 --------->WRKY18(1)      <---
----ANAC46       --------->KAN1 --------->YAB1    <---------ZAT6   <---------YAB5 <-----------HVH21-
tctttgattcggatatttgtttatcctcaagtctttcatcgtttggttttgtagtgttgacatggacatcatcagtcaatgtccggatcacttgctcttg  13326900
                                    <---------O2              --------->GLK1(1)
                                    <---------TGA1a           <------ZmHOX2a(2)
                                    ==========================bZIP_DOF <---------RVE1(2)
                                    --------->TGA1a          --------->GATA12
                                <-----------TGA1             --------->ARR11(2)
               <---------ETT(1) <-----------HVH21            --------->ARR11(3)
          --------->KAN1<---------ARR11(3)                   --------->ARR14(2)
    <-----------HVH21   --------->ARR11(3)<----------DOF2    <---------ARR11(3)
-------->ARR14(2)     --------->DOF5.7(1)<---------DOF5.7(1) <---------GATA12   <------NtERF2
---------ARR11(2)   ==========================bZIP_DOF       <---------ARR11(2) ----------------->AGL1
---------ARR14(2)   ---------->DOF2 --------->O2        --------->ALFIN1    <---------ANAC58
------ANAC46   <----------ID1 <---------YAB5         --------->DOF5.7(1)   <---------MYB46(3)
-------->ARR11(2)  <XXXXXXXXXXXXXXXXXXXXXMIR447C   ---------->DOF2<----------DOF2             <-----
cgaatactgtcatttattccgacaaaagatgtcatcgtcacgagtcttttgtccaaaagatggggatctctttggagatgggtgccaaaacttgaatatg  13327000
                     <---------ANAC58                                                      ---------
                   --------->GLK1(2)                                             --------->At4g35610
                  <---------GLK1(2)                                              <---------At4g35610
                  --------->GATA12                                              ------->TEIL  <-----
                  <---------RVE1(2)                    <-----------GT1     <---------ANAC58<--------
    --------->ANAC58 <---------ANAC58                  --------->MYB52(1)  <---------ANAC58---------
    --------->ANAC46 <---------ANAC46                 <---------KAN1     --------->ARR11(3)<--------
    --------->ANAC58<-------TEIL          <----------DOF2           --------->HSFB2a(2)   <---------KAN1
<-----------GT1  --------->KAN1        <---------ARR11(3)           <---------HSFB2a(2) --------->YAB1
----YAB1     --------->TOE1(2)         --------->ARR11(3) ------->GAMYB  <---------ARR11(3)---------
attttacaagacaaaacatgagattcgtgaagtttgtttacaggtctttgctacagaataacgctccagttctcgagagcttgcatctcaagaatattat  13327100
     <---------YAB1                                                 <---------ZAT2
   --------->At4g35610                                              --------->At4g35610
   <---------At4g35610                                         <---------ANAC46
--------->KAN1        --------->ARR11(3)                       <---------ANAC58
---------DOF2         <---------ARR11(3)                       <---------ANAC58
---->ZmHOX2a(1)       <---------ARR14(2)                   <---------KAN1          <---------AHL20(2)
------>TOE2(3)        <---------RVE1(2)                  <---------ANAC58       <---------------AGL15
-----YAB1           ----------->ARR10                    <---------ANAC46       --------------->AGL15
-AHL20(3)         --------->LBD16                     <---------DEAR3(1)   <---------HSFB2a(1)
>AHL25(2)        <---------ANAC46                     <---------RAP2.3(3)  <---------HSFC1(2)      -
------GT1      --------->SPL7(1)                  --------->KAN1    <---------At4g35610--------->KAN1
-AHL25(2)    <---------SPL7(1)          --------->ARR11(3) --------->ALFIN1--------->HSFC1(2)      <
>AHL20(3)   <---------ANAC58            <---------RVE1(2)<---------ANAC58  --------->HSFB2a(1) <----
-AHL12(2)   <---------ANAC58   <------ZmHOX2a(1) <---------MYB52(1) --------->ZAT2 --------->AHL20(2)
>AHL12(2)  <---------------AtSPL3    <---------WOX13(1) <------NtERF2  ----------->GT1<---------YAB5
cctttatgctgaatgtcgtaccgtagatattggaggatggattgatattgcagttagtcggcgtgtgcgtgagctggaaatttctattaattgttcggat  13327200
     <---------YAB1                                                                         <-------
--------->AHL12(1)                  --------->ANAC58                                    <----------DOF2
<---------AHL12(1)            <-------MYC3                       <---------ICU4       --------------
-------->AHL12(1)             ------->MYC3      <-------TEIL --------->AHL20(2)    --------->KAN4(2)
---------AHL12(1)         <-------TEIL       --------->At4g35610<---------YAB5    --------->KAN1
-----KAN1          <---------ANAC46 --------->ANAC58   --------->ANAC46          <---------RVE1(2)
gaaaaattcagattgcctagtagcctatatacatgtggaacgcttgagagcttcatactcaccattaaacattgccatcttgtggatgttcctttagcgg  13327300
                                          <---------ANAC46                      --------->ZAT18
                                         <------MYB83                         <--------P
                                         <------MYB46(1)                     <-------GAMYB
                                      ----------------------->TaNAC69(2)     <---------MYB52(1)
                                      <---------ANAC58                      --------->LBD16
                                     --------->MYB55(2)                   <---------LBD16
                                     <---------MYB46(3)                 --------->ARR14(2)
                                     --------->ATHB12                   <-----------GT1
                                    <---------YAB5  ------->GAMYB       --------->ARR11(2)
                                    <---------AtMYB61                   <---------ARR14(2)
                      <---------ALFIN1<---------ANAC58                  <---------ARR11(2)
     <---------DOF5.7(1)     <---------ANAC46      --------->ANAC46    <---------CCA1(2)
--At4g35610           --------->REM1(1)<--------P  --------->ANAC58    --------->KAN1
--->AGL1    xxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)   --------->ANAC58   ----------->ARR10
tctgtctcccttccctcaaaaaactacaccttaggtgtattggttgggcatacaacgcaactcttcttaggcttatatccggttgcactaatcttgaaga  13327400
<- Previous    Next ->

AGI:  At4g26350.1   
Description:  F-box family protein. Identical to Putative F-box/FBD/LRR-repeat protein At4g26350 [Arabidopsis Thaliana] (GB:Q9STQ0); similar to F-box family protein [Arabidopsis thaliana] (TAIR:AT4G26340.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN74740.1); contains InterPro domain Leucine-rich repeat 2 (InterPro:IPR013101); contains InterPro domain FBD (InterPro:IPR013596); contains InterPro domain Cyclin-like F-box (InterPro:IPR001810); contains InterPro domain FBD-like (InterPro:IPR006566)
Range:  from: 13326862    to: 13328324    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version