AthaMap TU-Logo
Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                  <---------ANAC46       <-----------ARR10
                                                <---------MYB46(3)       --------->GLK1(2)   <------
----------------------ANAC81                    --------->MYB55(2)      <---------GLK1(2)  ---------
--ICU4        <---------MYB52(1)       ----------->ARR10  --------->MYB52(1)   --------->LBD16<-----
->ATHB12 <-----------GT1   --------->DOF5.7(1) <---------AtMYB61<---------ATERF1(1)       <---------LBD16
>ICU4  <-----------GT1   --------->DOF5.7(1)<---------DEAR3(1)--------->RAP2.3(1) --------->ZAT14
-YAB1<---------DOF5.7(1) ---------->DOF2  --------->CCA1(2)--------->DEAR3(2)<---------LBD16--------
ggttttcatttttctctgtttttttaaaaaaagaagagagagaagagacggtggtttagaaaaccggcgactcaagaatctccggtgaagtcttccggta  52500
                               --------->TOE2(3)                     --------->ANAC46 --------->DEAR3(1)
                               --------->TOE1(3)                     --------->ANAC58--------->ATERF1(1)
                             <---------TOE1(3)                       --------->ANAC55(2) --------->MYB46(3)
                    <---------ARR14(2)                               --------->ANAC58<------NtERF2
                    <---------GATA12                                 <---------ANAC55(2) <---------MYB55(2)
                    --------->GATA12                                 --------->ANAC55(1)--------->AtLEC2
                    --------->ARR14(2)                            <---------KAN1 <---------RRTF1(1)
      --------->ANAC58       <---------TOE2(3)                --------->DEAR3(1) ------>NtERF2------
      --------->ANAC58   --------->ANAC55(2)              <---------At4g35610    <---------ATERF1(1)
     --------->AtMYB61<-------TEIL                        <---------ZAT14       <---------DEAR3(1)
  --------->ANAC46----------->ARR10                       <---------ZAT2        --------->ANAC46
---MYB52(1)     <------ZmHOX2a(1)                         --------->At4g35610   --------->DEAR3(1)
>HSFB2a(2)   <---------LBD16--------->MYB52(1)            <---------ABI4(2)  --------->ANAC46-------
----CCA1(2)  <-----------RAV1(2) --------->ARR11(2)--------->LBD16--------->ARR14(2)------>NtERF2---
->LBD16 <---------ALFIN1 --------->ANAC46        <---------LBD16  --------->ARR11(2)<---------ATERF1(1)
tctctccaccagcacctcaggaagattcacttaacgtaaactcaaaaccctctccggagacagcaccgagttacgcaactacgacgccgccatccaacgc  52600
                                      --------->RVE1(2)                --------->ANAC55(2)
                                 --------->TGA2(2)                     --------->ANAC58
                                <-----------HVH21                --------->AHL25(3)
                               --------->ANAC46                  --------->AHL25(1)
                               --------->ANAC58                  --------->ICU4
                               <---------bZIP60(1)               --------->AHL20(2)
                               --------->bZIP60(2)               --------->AHL12(1)
              --------->DEAR3(1)<-----------TGA1                 <---------AHL12(1)
        <---------SPL7(1)      --------->O2                     <---------KAN1
        <-----------HVH21      <---------O2                    --------->ARR11(2)
       --------->DEAR3(1)      --------->TGA1a                 --------->GATA12
---------->DOF2     <---------ZAT18 <---------At4g35610        <---------GATA12
=========================================bZIP_DOF              --------->ARR14(2)                <--
=================bZIP_DOF      --------->bZIP60(1)             <---------ARR11(2)            <------
=================MYC_MYB       <---------TGA1a                 <---------ARR14(2)           <-------
=========================================MYC_MYB       --------->DEAR3(1)                 <---------ZAT2
-->DEAR3(1) --------->LBD16    <<<<<<<<<<AtbZIP1  --------->ANAC58     <---------ANAC55(2)--------->At4g35610
-----LBD16  ------>NtERF2      --------->ANAC58   --------->ANAC58     --------->ANAC46   <---------At4g35610
->GAMYB--------->TGA1a <---------ALFIN1           --------->ANAC46     --------->ANAC58<---------At4g35610
-->ANAC46 --------->SPL7(1)   ------>NtERF2--------->ANAC46   <------NtERF2         <-----------GT1
------>LBD16<------NtERF2    <---------ALFIN1 --------->KAN1<---------ANAC46      <---------WOX13(2)
cggtaaacccccgtccgccgtagtccccatcgccacgtcagcatctaagacactcgcaccgaggcggatttattacgcaagagaaaattacgctgctgtt  52700
                    <---------CCA1(1)                           <---------AHL20(3)
                    <---------RVE1(1)                           <---------AHL20(2)
                    <---------GLK1(1)                           --------->AHL20(3)
                   <---------RVE1(2)--------->AHL12(2)          --------->AHL25(1)
                   <---------ARR11(3)                           --------->AHL20(2)                 <
                   --------->ARR11(3)             --------->AHL20(3)                         <------
                   --------->ARR14(2)             <---------AHL12(3)      ------>MYB83      <-------
                   <---------ARR14(2)  --------->YAB1          <---------DOF5.7(1)  --------->HSFB2a(2)
                   <---------ARR11(2)  <---------ICU4    <----------DOF2  ------>MYB46(1)   <-------
                  <------ZmHOX2a(1)--------->YAB1 --------->AHL12(3)      -------->P<---------HSFB2a(2)
-------YAB5    <---------At4g35610<---------ATHB12<---------AHL20(2)    ------->GAMYB   <---------ZAT18
-GAMYB    <----------DOF2<------MYB83<---------YAB1   <-----------GT1  --------->MYB46(3)   <-------
----RAV1(1)<-----------HVH21      --------->ICU4  <---------AHL20(3) <-----------GT1--------->HSFC1(1)
gtcatccagacttctttcagaggatatttggtgagcaattattaatgacctatatttttactttcatttttttaaccaacttgacttctagaccactttt  52800
                                                    -------->P                        <---------AHL25(2)
                                                   <-----------GT1                    --------->AHL25(3)
                                      <---------ANAC58                                --------->AHL12(3)
                                      <---------ANAC46    --------->AHL20(2)          <---------AHL12(1)
                                      <---------ANAC58    <---------AHL20(2)          --------->AHL12(1)
                                  <------------CBF------>ZmHOX2a(2)                   <---------AHL25(3)
                                <---------TOE2(3)<------ZmHOX2a(2)                    --------->AHL25(1)
                                <---------YAB5   --------->CCA1(2)                   --------->AHL12(2)
                                <---------YAB1  --------->RVE1(2)                    <---------AHL12(2)
          <---------ANAC58     <-----------GT1  --------->AGP1 --------->ATHB12     --------->AHL25(2)
          <---------ANAC58  --------->AHL12(2)  --------->ARR14(3)                  --------->AHL12(2)
          --------->ALFIN1  <---------AHL12(2)  --------->ARR11(2)                  <---------AHL12(2)
     <---------ATHB12       <---------WOX13(2)  <---------GATA12                    --------->AHL20(3)
     --------->ICU4         --------->WOX13(2)  --------->GATA12<------------CBF    <---------AHL20(3)
 ------------>CBF         <---------AHL20(2)    <-----------ARR10                   <---------AHL25(2)
---------ZAT6             <---------AHL20(3)    <---------ARR14(3)                 --------->AHL12(1)
---DOF5.7(1)              --------->AHL20(3)    <---------ARR14(2)                 <---------AHL12(1)
--DAG2--------->YAB1      --------->AHL20(2)    --------->ARR14(2)     <---------GLK1(1)
---DOF2 <---------ANAC46 --------->AHL20(2)     --------->ARR11(3)     --------->GLK1(1)
--DOF5.7(1)             ----------->TBP         <---------ARR11(3)  *TSS         <---------RVE1(2)
tagtgacaatgatgtgtgtctatgtctataaaattaacattgcttatacaagatctaccatttaaaagattgggatttcatttagataatttttttttgg  52900
                       --------->WOX13(2)                        --------->MYB52(2)
                       <---------WOX13(2)                      <--------P    --------->ANAC58
                   <-----------------AGL1                --------->DOF5.7(1) --------->ANAC58
                   <-----------------AG                  ---------->DOF2     --------->ANAC46
                 <----------DOF2       --------->DOF5.7(1) --------->DOF5.7(1)         --------->ALFIN1
              ---------->ID1   --------->DAG2   --------->DOF5.7(1)      --------->CCA1(2)
gtcttgatataagttttgttctttctaatttggtaaggcaagaagagcattaagagcattaaaagggttagtgaagctacaagcattggtgaggggacat  53000
                                                           <---------O2  ------>MYB46(1)
                                                           --------->O2  ------>MYB83
                                                           --------->TGA1a--------->ANAC58        --
                                                           ========================MYC_MYB      <---
                                      <---------ZAT2<---------ZAT18     --------->MYB52(1)    <<<<<<
          --------->ANAC58           --------->ANAC58      <---------ANAC58         <---------KAN1<-
          --------->ANAC58           --------->ANAC58      <---------ANAC46------->GAMYB     -------
      --------->ANAC58       --------->ALFIN1       --------->ZAT14    --------->AtMYB61    --------
      --------->ANAC58    <---------TOE1(3)         --------->ZAT18   --------->MYB46(3)   ---------
    ---------->DOF2       <---------TOE2(3)         <---------ZAT14 <---------WRKY18(1)    ---------
aatgtgagaaagcaagctaaaatgacattaaggtgtatgcaagctctggttcgagtccagtctcgtgtgcttgaccaacgcaaacgcttgtctcatgacg  53100
      <---------ARR11(2)                                                --------->ANAC58
      <---------ARR14(2)                                                --------->ANAC58
      --------->ARR14(2)                                           <---------ETT(2)
      --------->RVE1(2)                                           <------ZmHOX2a(2)
      --------->ARR11(2)                                          ==================================
      <---------GATA12                                           <---------GATA12
      --------->GATA12                                           --------->GATA12
     <---------GLK1(1)                                           --------->ARR11(2)
     --------->GLK1(1)                                           <---------ARR14(2)
     --------->KAN1                                              <---------ARR11(2)
------->MYB52(2)                                                 --------->AGP1
------MYB52(1)                                                   --------->ARR14(2)
<<<<AtTINY2                            --------->GATA12         --------->At4g35610
--------MYB46(3)                       <---------GATA12     <-----------HVH21
-->RAP2.6(3)               --------->ANAC58             <---------ARR11(3)
->MYB52(1)    <---------ZAT14          ------->TEIL     --------->GATA12--------->RVE1(2)          <
-->HVH21  --------->LBD16  --------->ANAC46             <---------ARR14(2)                         <
-->TGA1 <---------LBD16    --------->ANAC58             --------->ARR14(2)      <--------P    ------
gtagtcgcaaatccgcgttcagtgactctcacgctgtttttgaatctcgctatcttcaagatttgtcagatcgacaatccatggttagtatagcctccta  53200
                                                                      --------->YAB1               -
                           <---------RVE1(2)                         <---------YAB5                <
                       --------->WOX13(2)                 <---------DOF5.7(1)    <---------At4g35610
=HOX2a_HOX2a           <---------WOX13(2)                <----------DOF2   ----------->GT1        <-
---------ANAC58     <---------YAB5                       <---------DAG2   <---------TOE2(3) <-------
---------ANAC58  <---------KAN1                         <---------ANAC58  <---------TOE1(3) <-------
>ZmHOX2a(1)    --------->YAB1                           <---------ANAC58  --------->DAG2 <----------
ggccttgcctaaactatagcataatcaattgatatgttttttagttatagacatgttttgctttttagtttattcataaggttaagctgtttttagcatg  53300
                                          <-----------GT1                               --------->ANAC58
                                       <---------ICU4                                   --------->ANAC46
--------->STY1(2)                      <---------AHL25(1)                               --------->ANAC58
-------->ARR14(2)                      <---------AHL12(1)                           <----------DOF2
---------ARR14(2)                      --------->AHL12(1)                          --------->YAB5
-------->RVE1(2)                      <---------YAB1                              <---------ATHB12
---------ARR11(2)                  --------->ICU4                            <-----------GT1
--------CCA1(2)                  <---------ANAC58     <---------TOE1(2)   --------->AHL20(3)
--ANAC58       <-------TEIL --------->ALFIN1 <----------DOF2              <---------AHL20(3)
--ANAC58       <---------ZAT18   <---------ANAC46     <---------TOE2(3)   --------->AHL12(3)
-GT1       <-----------RAV1(1)   <---------ANAC58     <---------TOE2(2)  --------->AHL12(2)  -------
cctatctagttcaaatggtgcattcacataggtgtgccttgattatttctttactcttaggtatacatattttgtatatttttcaatctttaagcaattc  53400
<- Previous    Next ->

AGI:  At1g01110.1   
Description:  IQD18 (IQ-domain 18). similar to IQD17 (IQ-domain 17), calmodulin binding [Arabidopsis thaliana] (TAIR:AT4G00820.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO24314.1)
Range:  from: 52869    to: 54685    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version