AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                  --------->ARR14(2)
                  <---------ARR14(2)
                  <---------ARR11(2)
           --------->ATHB12
          <---------YAB1
         <----------DOF2                                             <---------YAB1
        ==============================================================MADS_MADS
        <-----------------AGL3                              <---------HSFB2a(2)
        --------->YAB1<---------At4g35610             --------------->AGL15
-------->ANAC58   --------->ARR11(2)                  <---------------AGL15                        -
-------->ANAC46 <---------ANAC58           <<<<<<<<<TBF1    --------->HSFB2a(2)           --------->ATHB12
-------->ANAC58 <---------ANAC58 <-----------GT1<----------DOF2    --------->YAB1    --------->ARR11(3)
--DOF2<---------ARR11(3)      <----------DOF2  <---------DOF5.7(1)----------->GT1    <---------ARR11(3)
 
agacgacactatctttattgggttctgcttctcctttaactacttcttcttctttttcttcatcgagaactgataattctgaagaagagaccttgatttg  46600
                        --------->DOF5.7(1)
             --------->DOF5.7(1)
           ---------->DOF2                                                         --------->DOF5.7(1)
      <---------At4g35610                                                 --------->GLK1(2)
      --------->At4g35610           <---------YAB1                       <---------GLK1(2)
<---------MYB46(3)    ---------->DOF2  ---------->DOF2                  --------->KAN1
-------->ALFIN1<----------ID1--------->DOF5.7(1)                       <---------RVE1(2)      >>>>>>
 
aagtggttgagctacaaagggacgagaaagagaagagtgatgaaaagaattggaagaagagaattgaagtttcagagattctaagtaagagtaagaagaa  46700
                                                                                      --------->RVE1(2)
                                                                                 <------NtERF2
                                                                                <---------RAP2.6(3)
                                                                                ------>NtERF2
                                                                                <------NtERF2
                                                                               --------->ANAC58
                                                                               --------->ANAC58
                                                                               --------->DEAR3(1)
                                                                               --------->RAP2.6(2)
                                                                              --------->RAP2.3(1)
                                                                              --------->ATERF1(1)
                                                                             --------->ATERF1(1)
                                                                  <---------ANAC58   --------->ATHB51
                                                         --------->DAG2<-----------RAV1(2)
                                                      --------->ARR11(3)     <---------ATERF1(1)
                                                >>>>>>>>>TBF1     <---------ANAC58  --------->ICU4
                                          --------->HSFB2a(2) <---------GLK1(1)--------->RAP2.3(2)
                                          <---------HSFB2a(2) --------->GLK1(1)--------->RAP2.3(3)
      <---------TOE1(3)                --------->GATA12 --------->MYB52(1)<------ZmHOX2a(1)
      <---------TOE2(3)                <---------GATA12--------->CCA1(2)  --------->ATERF1(1)<------ZmHOX2a(1)
>>>TBF1                --------->GLK1(1)<------ZmHOX2a(2)--------->DOF5.7(1)<---------ATERF1(1)    -
 
gaagagattagggttttgtatttgggaattgcattgtgagacgatcgagaagaagaagataagggaattgcgaagcaggaggccgccattatcgaaggac  46800
                      --------->ATHB12
                      ----------->GT1
                      --------->YAB5
                      --------->YAB1
                     --------->ICU4
                     <---------KAN1
        <---------AHL12(1)
        --------->AHL12(1)
        <---------AHL25(1)
        --------->AHL20(2)
        <---------AHL25(3)
        --------->AHL25(1)
        --------->ATHB51
        <---------AHL12(3)
        <---------AHL20(2)
        --------->ATHB12
       <---------AHL20(1)
       <---------AHL20(2)                                           <-----------HVH21
       --------->AHL20(2)                                      <---------ARR14(2)
       --------->AHL25(3)                                      --------->ARR14(2)
       <---------AHL25(2)                                <----------ID1
       <---------AHL25(1)                           <---------AHL25(3)
       --------->AHL12(3)                           <---------AHL25(1)
       --------->AHL25(1)                           --------->AHL20(2)
       --------->AHL25(2)                          --------->AHL20(3)               --------->ANAC46
       <---------AHL12(1)                          --------->AHL20(2)               ----------->GT1
       --------->AHL12(1)                          --------->AHL25(1)        <---------WOX13(2)
      <---------AHL12(2)                           --------->AHL25(3)    <-----------HVH21
      --------->AHL12(2)         ---------->DOF2   <---------AHL20(3)  <---------MYB46(3)
      <---------WOX13(2) --------->AHL20(2)        <---------AHL12(3)  <---------DEAR3(2)
   --------->AHL20(2)<---------YAB1           ----------->GT1  <---------GATA12 <-----------GT1 <---
 ----------->GT1     <---------YAB5      --------->AHL20(2) <---------KAN1   --------->WOX13(2) ----
--------->DOF2     --------->YAB1--------->DOF5.7(1)<---------AHL20(2)--------->ETT(1)         -----
 
cagaaagtaaattatttgagaagaatgattaaaaaaaaaagaaatgaaatagaaattaatagaacaaatcgggtcgggtcatttaacccgttacaatcct  46900
                --------->At4g35610
              <-----------RAV1(2)
             --------->TGA2(2)                                                                     -
            <-----------HVH21                                                                      <
            --------->TOE2(3)                                                                     <-
           --------->ANAC58                                                                       --
           --------->O2                                                                           <-
           --------->ANAC46                                                                       --
           ==============================bZIP_DOF                                                 --
           --------->REM1(1)                                                                      <-
           --------->ANAC58                                                                       --
           --------->bZIP60(2)                                                                    <-
           <---------bZIP60(1)                                                                    --
           <---------O2                                                                           --
      --------->ANAC46                                                                            <-
   --------->ARR14(2)                    <---------TOE1(2)                                      <---
   --------->ARR11(2)              --------->ANAC46                                            <----
   <---------ARR11(2)              <---------ANAC58                  --------->DOF5.7(1)       -----
   <---------ARR14(2)  --------->KAN1   <-----------RAV1(2)          --------->DAG2           ------
  --------->KAN1<---------At4g35610<---------ANAC58                 ---------->DOF2 --------->WOX13(1)
------ZAT2 --------->TGA1a       <---------ANAC46                   --------->DOF5.7(1)     <-------
----->ZAT2 --------->bZIP60(1)<----------DOF2                      ---------->DOF2<---------YAB1----
->ZmHOX2a(1)<-----------TGA1 <---------DOF5.7(1)      <---------AtLEC2     ---------->DOF2--------->AHL20(2)
 
gctcggtattcgctacgtcagatgagacactctctttcgcgtagcaggttttgtttttcatgaaataaacaaaaggcccaaagttataaatcaaaaaata  47000
  <---------AHL25(3)
  <---------AHL12(1)
  --------->AHL12(1)
 --------->AHL25(2)
 <---------AHL25(1)
 --------->AHL25(1)
 --------->AHL25(3)
 --------->AHL12(3)
 --------->AHL12(1)
 <---------AHL12(1)
 <---------AHL12(2)
 <---------AHL25(2)
--------->AHL25(2)
--------->AHL12(2)
<---------AHL12(2)
--------->AHL12(3)
<---------AHL25(2)
<---------AHL12(3)
-------->AHL12(2)
---------AHL12(2)
--------AHL20(2)
------->AHL12(1)
--------AHL12(1)
------->AHL20(3)
------->AHL20(2)
--------AHL20(3)
------->AHL25(3)                                        --------->WOX13(2)
--------AHL25(2)                                      --------->AHL20(2)
------->AHL25(2)                               ------>MYB83
------->AHL25(1)                             <---------MYB46(2)
--------AHL25(1)                             <---------MYB59
------AHL12(2)                          <---------DOF5.7(1)
-----AHL25(3)                           <----------DOF2 <---------WOX13(2)
---->AHL20(2)                           <---------DAG2<---------AHL20(2)<------ZmHOX2a(1)     <-----
--->AHL20(2)                           <---------DOF5.7(1)   ---------->DOF2                  ------
--AHL12(2)        *TSS           --------->KAN1------>MYB46(1)   ---------->DOF2              <-----
----->AHL12(2) <---------YAB1  <---------DOF5.7(1)  <----------DOF2 --------->TOE1(2)         ------
 
aaaaattattcaaacattttcatttcttcaagtctcttattccctttaccaaacactttaattacaaagaaagtaggagccatgaaattagaaccagtgc  47100
                                                                                       --------->ARR14(2)
                                                                                       --------->GATA12
                                                                                       <---------GATA12
                                                                                       --------->GLK1(2)
                                                                                       <---------ARR14(2)
                                                                                  <XXXXXXXXXXXXXXXXX
                              --------->KAN1                                    <---------ZAT6
                             <---------YAB5                                <---------MYB46(3)
                           --------->YAB1    --------->GATA12             --------->ALFIN1
                      ------>ZmHOX2a(1)      <---------GATA12           <------MYB46(1)--------->ARR11(2)
----ZAT18            --------->TOE2(3)      --------->REM1(1)           <------MYB83  <---------GLK1(2)
------>CBF       --------->KAN1        --------->ZAT6                  <---------AtMYB61<---------KAN1
----ZAT14        --------->YAB1        --------->YAB5          <----------CDC5  <---------YAB5
--->ZAT14       <---------ATHB12 <---------ICU4   --------->REM1(1)    --------->DOF5.7(1)     <----
 
aatcttgtctaatggcccattcatcctcaatcttcattctgaccactacatctacaactccttggctctgagggaaggtggtagtgatagaatctgctat  47200
                                                           --------->ZAT14
                                                           <---------ZAT14
                                                          ----------->RAV1(1)                     --
                                                    --------->ANAC58                              <-
                                                    --------->ANAC58                              --
                                                    --------->ANAC46                              <-
                                                --------->AtLEC2          --------->ARR11(3)      <-
       <-----------HVH21                     <---------MYB52(1)       <----------DOF2             --
  <---------GLK1(1)                         <-------GAMYB--------->ANAC46 <---------ARR11(3)      --
XXMIR3434                                  ------>ZmHOX2a(2)  <<<<<<<<<TAC1 ------>ZmHOX2a(2)     <-
-----YAB1                              <---------ATHB12--------->AtMYB61  <---------RVE1(2)      <--
 
gtttgaactccctcagaggtttgaagctatattttgacccaaatgatcgttatgcaaaccacaacactgtcttctttgatcttactatgaagaagtctgc  47300
          ---------->DOF2
    <---------TOE1(3)          --------->CCA1(2)
    <---------TOE2(3)       --------->ANAC58
------->ARR14(2)            --------->ANAC58
--------ARR11(1)        --------->ANAC58                 --------->DOF5.7(1)
------->GLK1(2)         --------->ANAC58               ---------->DOF2                  <---------AtLEC2
--------ARR11(3)        --------->ANAC46             <------ZmHOX2a(1)        --------->At4g35610
--------GATA12       --------->AHL20(3)             <----------ID1            <---------At4g35610
------->ARR11(3)     <---------AHL20(3)        ---------->DOF2           --------->ALFIN1 <---------KAN1
------->GATA12      --------->YAB1       <---------REM1(1)           --------->ZAT14    <---------ANAC58
--------ARR14(2)   <---------YAB1--------->AtLEC2--------->DOF5.7(1) <---------ZAT14    <---------ANAC46
-------CCA1(2)     <---------AHL20(2)   ------------------------>ANAC81<---------ANAC46 <---------ANAC58
 
aaatcttgaggtttaaagctatattataagcaagctatgcagagatgaagcaaagaggaaaagagttttctgtgctgtggaagctgtattggcatgtatt  47400
                                                                                              <-----
                                                                                              ------
                                                                                            <-------
                                                                                           <--------
                                                                                           ---------
                                                                                          --------->YAB1
                                                                                        --------->AHL20(3)
                                                                                        --------->AHL12(2)
                                                                                        <---------AHL20(3)
                                                                                        --------->WOX13(2)
                                                                                        --------->AHL12(3)
                                                                                        <---------AHL12(2)
                                                                                        --------->AHL25(2)
                                                                                       <---------ICU4
                                                                                       <---------AHL25(3)
                                                                                       --------->YAB1
                                                                                       --------->YAB5
                                                                                      --------->AHL12(3)
                                                                                      <---------AHL20(2)
                                                                                      --------->AHL20(2)
                                                                                      --------->AHL12(1)
                                                                                      --------->ICU4
                                                                                      <---------AHL12(1)
                                                                                      <---------ATHB51
                                                                                      <---------AHL25(3)
                                                                                      --------->AHL25(3)
                                                                                      --------->AHL25(2)
                                                                                      <---------AHL12(3)
                                                                                      <---------AHL25(1)
                                                                                     --------->AHL12(2)
                                                                                     <---------AHL25(2)
                                                                                     --------->AHL25(3)
                                                                                     --------->AHL25(2)
                                                                                     --------->AHL20(3)
             <---------ANAC46        ------>ZmHOX2a(1)                               <---------AHL20(1)
             <---------ANAC58        <-----------RAV1(1)                             --------->AHL20(2)
             <---------ANAC58      ----------->RAV1(2)                    --------->LBD16<---------YAB5
     --------->ANAC46     <---------SPL7(1)                         <---------YAB5   <---------AHL20(3)
<---------YAB1      <---------WOX13(1)                              --------->MYB46(3)--------->AHL25(1)
 
gttcttatacgagattgtgtgtaattggtggtactggctcctgttgcagagcccatcttgtttagagtgtaatcacccgaggttgcaaaataattatctt  47500
<- Previous    Next ->

AGI:  At1g01080.1   
Description:  33 kDa ribonucleoprotein, chloroplast, putative / RNA-binding protein cp33, putative. similar to CP33 (PIGMENT DEFECTIVE 322), RNA binding [Arabidopsis thaliana] (TAIR:AT3G52380.1); similar to 31 kDa ribonucleoprotein, chloroplast, putative / RNA-binding protein RNP-T, putative / RNA-binding protein 1/2/3, putative / RNA-binding protein cp31, putative [Arabidopsis thaliana] (TAIR:AT5G50250.1); similar to 29 kDa ribonucleoprotein, chloroplast, putative / RNA-binding protein cp29, putative [Arabidopsis thaliana] (TAIR:AT1G60000.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO24325.1); contains InterPro domain RNA recognition moti
Range:  from: 45296    to: 47019    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At1g01090.1   
Description:  PDH-E1 ALPHA (PYRUVATE DEHYDROGENASE E1 ALPHA); pyruvate dehydrogenase (acetyl-transferring). similar to AT-E1 ALPHA (pyruvate dehydrogenase complex E1 alpha subunit), pyruvate dehydrogenase (acetyl-transferring) [Arabidopsis thaliana] (TAIR:AT1G59900.1); similar to unknown [Populus trichocarpa] (GB:ABK95003.1); contains InterPro domain Dehydrogenase, E1 component; (InterPro:IPR001017)
Range:  from: 47485    to: 49286    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version