AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                       ====================bZIP_DOF
                                                                       ====================bZIP_DOF
                                                                       <---------ANAC46
                                                                       --------->O2
                                                                       --------->TGA1a
                                                                       <---------O2
                                                               <---------KAN1
                                                               <---------HSFB2a(1)
                                                               --------->HSFB2a(1)
                                                              <---------GATA12
                                                              --------->GATA12
                                                              <---------ARR11(1)
                                                              <-----------ARR10
                                                              --------->ARR11(2)                  <-
                                   --------->MYB46(3)         <---------ARR14(2)              <-----
                                 ------>MYB46(1)              --------->ARR14(2)            --------
                                 ------>MYB83                 --------->GLK1(2)             <-------
                               --------->AtMYB61              <---------ARR11(2)            <-------
                         --------->bZIP60(2)        =============================bZIP_DOF   --------
              --------->GLK1(1)<---------MYB46(2)   <----------DOF2    --------->bZIP60(1) ------>NtERF2
              <---------GLK1(1)--------->MYB46(3)  <---------DOF5.7(1) =============================
        --------->HSFB2a(2)   --------->ANAC46    <------NtERF2<---------HSFC1(2)       --------->LBD16
        <---------HSFB2a(2)--------->ZAT14       ------>NtERF2------->TEIL              ------>NtERF2
       <---------LBD16   --------->TGA1a        <---------ANAC46    ----------->HVH21  --------->ANAC46
      <---------LBD16    ======================================bZIP_DOF<---------TGA1a --------->ANAC58
   --------->KAN1        --------->O2        --------->DEAR3(1)--------->HSFC1(2)      --------->ANAC58
   <----------DOF2     <---------ALFIN1     <---------LBD16  <---------CCA1(2)        <---------LBD16
   ================================bZIP_DOF--------->MYB52(1)<---------ARR14(1)      ------>ZmHOX2a(1)
---->DOF2--------->LBD16 --------->ANAC46 <---------ALFIN1   <---------GLK1(2)  <----------DOF2 <---
 
agcgcgattttcgggagaaatctctcccacttcaccaaaccatcaacaccggcgtctttcttccgaatcttccgacgtgataactttcctccgccagctt  8358500
              <---------MYB52(1)
             <-----------TGA1
         <---------ALFIN1
         ------->GAMYB                             ----------->RAV1(1)
        --------->MYB46(3)                        --------->ANAC46
   <----------DOF2                             <---------YAB1
 <-------TEIL<-----------HVH21                --------->RVE1(2)
--------At4g35610                            <---------ICU4
------HVH21 --------->DEAR3(1)              --------->ICU4
->At4g35610 --------->DREB2C(2)             <---------YAB1                             --------->ATHB12
--At4g35610 --------->ANAC46              --------->YAB1                              <---------ATHB51
--ZAT2  <---------MYB55(2)                <---------ICU4                     --------->TOE2(3)
->ZAT2<-----------GT1                    <---------YAB5                      --------->TOE1(3)    >>
=================MYC_MYB        --------->ANAC46<-----------GT1              <---------MYB59   >>>>>
--------RAV1(2)                ------>ZmHOX2a(1)--------->YAB1     <----------DOF2    <---------YAB1
 
caggtgctttaaccaccgtcacttcaactacttcctcgctactagtcattatcacaacacaaacacttagctttgaaaaacctaaatcgattattgaaga  8358600
                                              <---------AHL25(1)
                                              <---------AHL12(3)
                                              <---------AHL12(1)
                                              --------->AHL12(1)
                                             <---------ARR11(3)
                                             --------->AHL25(2)
                                             --------->AHL20(3)
                                             <---------AHL12(1)
                                             <---------AHL25(2)
                                             <---------AHL20(1)
                                             --------->AHL25(3)                               ------
                                             --------->AHL12(1)                          <---------ARR11(3)
       --------->At4g35610----------->GT1    --------->AHL20(1)                          --------->ARR11(3)
    ---------->DOF2    ------------>MYB.PH3(1)<---------AHL25(3)                     --------->DOF5.7(1)
 >>>>>>>>>TBF1    --------->DOF5.7(1)    --------->YAB1      ----------->GT1         ---------->DOF2
>>>>>>>TBF1     ---------->DOF2         <---------ATHB12 <---------ZAT14     ----------->GT1<-------
>>>>TBF1    --------->LBD16            --------->RVE1(2)--------->ALFIN1 --------->DOF5.7(1)<-------
 
agaagaagaaagctccagagaaagagaaacagttacaaaacaaatcaaaatatttgtgagtggagagataaatgagaagagagcaaaaaaaagaacttta  8358700
                                                                                       ------>MYB46(1)
                                                                                      --------->ORA47(1)
                                                                                     --------->DEAR3(1)
                                                                           <------MYB46(1)
                                       --------->ARR11(3)                  <---------ANAC58
                                       <---------GATA12                    <------MYB83------>MYB83
                                       <---------ARR11(3)                  <---------ANAC58
                                       --------->RVE1(2)                  --------->MYB55(2)
                                       --------->GLK1(2)             ---------->DOF2--------->DEAR3(2)
                                ----------->GT1                   <---------WOX13(1)--------->MYB46(3)
                            --------->ARR11(3)                  --------->ATHB12  --------->ARR11(2)
                            --------->RVE1(2)                   --------->YAB5    <---------ARR11(2)
                            <---------ARR11(3)                 --------->ICU4    <---------SPL7(1)
                           --------->RVE1(1)                   <---------YAB1<---------DEAR3(1)-----
                       --------->AHL20(2)                   <---------ARR11(2)  <---------ANAC58 ---
              ----------->GT1  <---------HSFB2a(2)          --------->ARR11(2)  <---------ANAC58----
     <---------YAB1---------->DOF2    --------->RVE1(1)     <---------MYB52(1) <------NtERF2 -------
--->KAN1     --------->ALFIN1  --------->HSFB2a(2)     --------->MYB52(1) <---------MYB46(3) -------
---DOF2    <---------ANAC46--------->CCA1(1)     <---------KAN1<---------YAB5--------->ALFIN1<------
--DAG2--------->YAB1 ----------->GT1 --------->AHL12(1)<-----------GT1   --------->ALFIN1    <------
 
ttctttctataatagtgtggagaaaagaaaatatctagaaaaaatctagcgaatgttttaacggttatgattgaaagtgggtggcgaaccgaccatgatc  8358800
                                                             <-------MYC3
                                                             ------->MYC3
                                                            <---------TGA1a
                                                            <---------O2
                                                            --------->TGA1a
                                                            --------->O2
                                                            ========================================
                                                        <-----------------PIF3(1)
                                                      --------->ALFIN1
                                                    <---------O2
                                 --------->RVE1(2)  --------->O2
                                --------->RVE1(1)   <---------ANAC58
                                --------->CCA1(1)   --------->TGA1a
                               --------->AHL25(2)   <---------ANAC58
                               <---------AHL25(2)   <---------bZIP60(1)
                              --------->AHL12(2)    <---------TGA1a
     <---------HSFB2a(2)      <---------AHL12(2)    --------->bZIP60(1)
     <---------ANAC46         <---------AHL12(3)    <---------bZIP60(2)
   <---------MYB46(3)   ----------->GT1             <---------ANAC46 --------->bZIP60(2)          --
->ZmHOX2a(2)         --------->GATA12               >>>>>>>>>>AtbZIP1===============================
------>MYB52(1)      <---------RVE1(2)            <---------TGA2(2)  --------->REM1(1)   --------->ANAC46
------->HVH21        <---------GATA12            ----------->TGA1    --------->O2     --------->ARR14(2)
-->ARR11(3)    <---------ARR14(2)<---------ARR11(3)----------->bZIP910(1) --------->At4g35610   ----
-->RVE1(2)     --------->ARR14(2)--------->ARR11(3)<-----------------------TaNAC69(2) <---------ARR11(2)
---GATA12 --------->DOF5.7(1) --------->AHL12(3) ----------->HVH21   --------->TGA1a  --------->ARR11(2)
---ARR11(3)   <---------KAN1--------->AHL20(2) --------->At4g35610 ----------->RAV1(1)<---------ARR14(2)
 
taacggttgtggaaagagtatttggatttgaaaaaatatctagtagaattggctgacgtggccacgtttgccacatcagcaaaatactgtatacgagaca  8358900
                                                                                                  --
                                                                                                  <-
                                                                                                  <-
                                                                                                  --
          --------->ANAC46                                                                        <-
          <----------ID1                                                                          --
          --------->ANAC58                                                                        <-
          --------->ANAC58                        <---------ANAC58                                --
       --------->ARR14(2)                         <---------ANAC58                                <-
       --------->ARR11(2)                        <------NtERF2                                    --
       <---------ARR11(2)                       <---------MYB46(3)                            ------
       <---------ARR14(2)                      <---------ANAC46                               <-----
    ------------>CBF                         <---------ANAC46                                 <-----
   <------ZmHOX2a(2)                         <---------MYB46(3)                               <-----
   --------->CCA1(2)                         <---------bZIP60(2)                              <-----
  --------->GATA12                          <---------AtMYB61                                 <-----
  --------->AGP1                            --------->ALFIN1                                  ------
  <---------GATA12                   <------------CBF                                         ------
  <---------ARR11(3)               --------->AHL12(1)                                         ------
  --------->ARR11(2)               <---------AHL25(2)                                        -------
  --------->ARR11(3)               --------->AHL25(2)                               <---------TOE1(3)
  <---------ARR11(2)               --------->AHL25(1)                               <---------TOE2(3)
 <---------GLK1(1)                 <---------AHL20(3)                              ---------->DOF2<-
 --------->GLK1(1)                 <---------AHL20(2)                             <---------AHL20(2)
=======bZIP_DOF               <---------TOE2(3)<---------RAP2.6(2)              <-----------TBP ----
------->DOF5.7(1)        <----------DOF2  <---------ANAC46           <-----------RAV1(1)     -------
=======bZIP_DOF   <-----------GT1  <---------AHL25(1)    <---------MYB52(1)<-------TEIL    <--------
------>DOF2     <---------MYB52(2) <---------AHL12(1)   <----------DOF2 ----------->GT1    ---------
 
aaagagatccaatacgccaaataaccttcttttaagaaaaaattggtgtggtggctagcctttggtttttctatgtggttcatatttaaagttggattta  8359000
          <----------DOF2          <---------TOE2(3)
     --------->YAB1         ------------>CBF
    <---------YAB1       <------------CBF
  <-----------GT1       --------->ATHB12
 <---------YAB1         <---------AHL20(2)
 <---------AHL20(2)    --------->AHL25(3)
<---------AHL12(2)     <---------YAB1
--------->AHL12(2)    <---------AHL12(2)
------->AHL25(2)      <---------AHL12(3)
--------AHL25(3)      --------->AHL12(2)
--------AHL25(2)     --------->AHL12(2)
------->AHL25(1)     <---------AHL12(2)
--------AHL20(3)     <---------AHL25(3)
------->AHL20(2)    --------->AHL25(1)
--------AHL20(2)    <---------AHL12(3)
------->AHL20(3)    <---------AHL25(1)
--------AHL25(1)    --------->AHL20(2)
------->AHL12(1)    --------->AHL12(3)
--->AHL12(3)        <---------AHL25(3)
----AHL20(2)        <---------AHL12(1)                                     <---------ANAC58
----AHL12(3)        --------->AHL12(1)                                   --------->ARR11(3)
----AHL25(2)       --------->AHL20(3)                             ----------->GT1
----AHL25(1)       --------->AHL20(1)                         <---------AHL25(3)
----AHL25(3)       --------->AHL25(2)                        --------->AHL25(1)
--->AHL25(3)       <---------AHL20(1)                        <---------AHL12(3)
--->AHL20(2)       <---------AHL25(2)                        <---------AHL25(1)
--->AHL25(1)       --------->AHL12(1)                        --------->AHL12(1)
-->AHL25(3)        <---------AHL12(1)                        --------->AHL20(2)              -------
--------AHL12(1)   <---------ARR11(3)                        --------->ICU4<---------ANAC58---------
----->AHL12(2)     --------->AHL25(3)--------->YAB5         <---------AHL25(2)           <----------DOF2
-->AHL20(2)    <---------MYB59 <------------CBF             --------->AHL25(3)       <<<<<<<<<<GT-3b
-GATA12   <---------DAG2<---------ICU4       ------->TEIL   --------->AHL25(2)    --------->AHL12(2)
>GATA12<-----------GT1--------->AHL12(3)  --------->ANAC55(2)<---------AHL12(1)  <---------AHL20(2)
 
attttttattatactttaccaaaatatttattgcaattgatgtttatgtatttgtgatggagaaatatttagtgaatttcttgtttatttttcttttaat  8359100
                                                                            <---------AHL20(2)
              <------------CBF                                              --------->AHL20(3)
      --------->ZAT6                                                        <---------YAB1
  <------ZmHOX2a(2)                                                         <---------AHL25(1)
 --------->ARR11(3)                                          <---------AHL20(2)
 <---------ARR11(3)                                        <---------AHL20(2)  <---------YAB1    <--
 <---------GATA12                                     --------->AHL25(3)    <---------AHL20(3)   ===
-->YAB1 --------->ANAC46   <---------ANAC55(2)      <----------DOF2    <---------AHL20(2)       <---
>AHL20(2)   <---------YAB5 --------->ANAC55(2)   <-----------GT1    ------->TEIL             <------
 
aagagatcaacactaaacattgaaactattacttatttgatgcttctaaattttacttttattttaaaatgtattttatattattgttcagacattttag  8359200
                                                         --------->RVE1(2)
                                                         <---------ARR11(3)
                                                        --------->RVE1(1)
                       <---------TGA1a                  --------->CCA1(1)
                       --------->O2                    <---------AHL25(2)
            <---------AHL20(2)                        --------->AHL12(2)
            <---------AHL25(1)                        <---------AHL12(2)
            --------->AHL12(3)                        <---------AHL12(3)
            --------->AHL20(3)               ------>MYB83--------->ARR11(3)
  <---------ANAC58     =================bZIP_DOF      --------->AHL12(3)
  <---------ANAC58 <---------ALFIN1        <---------MYB46(2)                               <-------
 --------------->AtSPL8--------->TGA1a     <---------MYB59                      --------->GLK1(2)
 <---------------AtSPL8<---------O2        --------->AtMYB61                    --------->RVE1(2)
--------DOF2<---------AHL20(3)          <-----------GT1--------->AHL25(2)   --------->DAG2  <-------
=================================bZIP_DOF  <---------MYB111(1)             ---------->DOF2  <-------
------RVE1(2)  --------->RVE1(2)     <---------KAN1 --------->AHL20(2)     --------->DOF5.7(1)
-----GT1   --------->YAB1    <----------DOF2 ------>MYB46(1)         <---------ZAT6        ---------
 
cttttgagtacctataaaaatcccactcgtgacttttgggataataccaaacccaaaaaatatctaatgctagtgggaaaaagtatctatacaaatttat  8359300
                                                                              <---------AHL12(2)
                                                                             --------->AHL12(3)
                                                                             <---------AHL20(2)
                                                                             --------->AHL25(1)
                                                                             <---------AHL12(3)
                                                                             <---------AHL25(2)
                                                                             <---------AHL25(1)
                                                                             <---------AHL25(3)
                                                                             --------->AHL25(2)
                                                                            --------->AHL20(2)
                                                                            <---------AHL20(1)
                                                                            <---------AHL20(2)
                           <-------TEIL                                     --------->AHL25(3)
                        ----------->GT1                                     --------->AHL25(1)
                        <------MYB46(1)                                     <---------AHL12(1)
                        <------MYB83                                        <---------AHL25(2)
                       --------->MYB59                                      --------->AHL25(2)
                       <---------MYB46(3)                          <---------CCA1(1)
                       --------->MYB111(1)                         <---------KAN1
                       --------->MYB46(2)                          <---------RVE1(1)
                <-----------GT1                                   --------->ARR11(3)
             <---------AHL25(2)                                   <---------ARR11(3)
             <---------AHL20(2)                                   <---------RVE1(2)
       --------->YAB1<---------MYB52(1)                         ----------->GT1
--AHL25(1)   --------->AHL20(3)                                <---------TOE2(3)
--AHL25(3)   <---------AHL20(3)                               --------->YAB1--------->AHL12(1)
--AHL12(1)   --------->AHL25(2)                <---------AHL20(2)<------ZmHOX2a(1)
>AHL20(3)  --------->AHL25(3)  <---------TOE2(2)   <---------AHL20(2) <-----------GT1         ------
 
ccaaaaacaattgtattattttctgtttggtacataggtttgcaatttgtttattttaaaaacaataaggatatttcaattttttttcacataagaaaat  8359400
<- Previous    Next ->

AGI:  At5g24470.1   
Description:  APRR5 (PSEUDO-RESPONSE REGULATOR 5); transcription regulator. Identical to Two-component response regulator-like APRR5 (APRR5) [Arabidopsis Thaliana] (GB:Q6LA42;GB:Q9FGE3); similar to APRR9 (PSEUDO-RESPONSE REGULATOR 9), transcription regulator [Arabidopsis thaliana] (TAIR:AT2G46790.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO48570.1); contains InterPro domain Response regulator receiver; (InterPro:IPR001789); contains InterPro domain CheY-like (InterPro:IPR011006); contains InterPro domain CCT (InterPro:IPR010402)
Range:  from: 8355954    to: 8358876    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version