AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
               --------->ANAC58               --------->YAB1
               --------->ANAC58           --------->KAN1   --------->MYB52(1)                    ---
      <---------RVE1(2)             <----------DOF2    <------ZmHOX2a(1)                       -----
      --------->GATA12        --------->RVE1(2)   --------->RVE1(2)                   <---------TOE1(3)
      <---------GATA12  <-----------GT1  <---------RVE1(2)<---------KAN1              <---------TOE2(3)
 
gtgagtgtcgatttggacaagcctatgttaccatctcaactttgcatattcaaaatcaggaataactgaaacagcttgagagcatacttaaggctagaga  6942500
                                                             <---------AHL12(1)
                                                             --------->AHL12(1)
                                                             --------->AHL25(3)
                                                             <---------AHL12(3)
                                                             <---------AHL25(3)
                                                             <---------AHL25(2)
                                                             <---------AHL25(1)
                                                             --------->AHL25(1)
                                                             --------->AHL25(2)
                                                --------------->AGL15
                                           --------->At4g35610  <---------YAB5
                                           <---------At4g35610<---------AHL25(3)
                                       <---------ALFIN1      <---------AHL20(2)
                                 <---------ARR11(3)          --------->AHL20(2)
                                 --------->ARR11(3)          --------->AHL20(1)
                                 --------->GLK1(2)          <---------AHL25(2)
                                --------->CCA1(1)           --------->AHL25(1)
                               --------->AHL12(1)    --------->DOF5.7(1) --------->WOX13(2)
                          ----------->GT1 <---------GATA12  --------->AHL25(3)
         -------->P      --------->HSFB2a(2)    ====================================================
   --------->DAG2        <---------HSFB2a(2)    <---------------AGL15    <---------WOX13(2)
  ---------->DOF2       <---------ANAC46  --------->GATA12  <---------AHL12(3)            <---------YAB5
  --------->DOF5.7(1)   <---------ANAC58  --------->ARR14(2)--------->AHL12(2)          --------->YAB1
-------->GT1            <---------ANAC58  <---------ARR14(2)--------->AHL20(2)   <-----------ARR10
------>GT1     <-----------HVH21--------->RVE1(1)    ---------->DOF2    --------->KAN1 <---------YAB5
 
gagaaaaaagctaaccagggtcgcattgctggaaaaaatcttccacatctgcaaaaaaaagaaattaattgttcttaattcgaagaactaagcatcatca  6942600
                                                           ------>ZmHOX2a(2)
                                                     ------>MYB83
                                                     --------->MYB52(1)
                                                     ------>MYB46(1)
                                                    --------->MYB55(1)
                                                   --------->MYB46(3)
                                                   <---------MYB111(1)
                                                   --------->AtMYB61
                                                   <---------MYB111(2)
                                                   <---------MYB46(2)
                                                   <---------MYB52(2)
                                                  --------->ANAC58
                                                --------->RAP2.6(2)
                                     ----------------->AGL3--------->YAB1
                                     ===============================================================
                <---------ZAT18 --------->DOF5.7(1)<---------MYB55(2)              <---------KAN1
                --------->ZAT18--------->DAG2--------->ANAC58                  --------->ANAC46
             ---------->DOF2   --------->DOF5.7(1)--------->ANAC58             --------->ANAC58
         --------->ZAT6       --------->DOF5.7(1)------>NtERF2          --------->GLK1(1)
    --------->TOE2(3)         ---------->DOF2--------->ANAC58           <---------GLK1(1)
 --------->RVE1(2)     <---------MYB46(3)  ---------->DOF2<------ZmHOX2a(2)    --------->ANAC58
=======================================================MADS_MADS<---------YAB1--------->LBD16
 
acacaatccataacactagagcacaattgttgaaaaagggtctaaataaagccaccaaacgatcgtcatgagaagaattcccacgaaaaactcaaaaccc  6942700
                          --------->DOF5.7(1)
                        ---------->DOF2
                     --------->ANAC58
                     --------->ANAC58                                       --------->ANAC46
                     ------------------------>ANAC81                        <---------DEAR3(1)
                    --------->DAG2                                    --------->At4g35610
              <----------DOF2                                         <---------At4g35610
              --------->TOE1(3)                                       <---------ZAT2         -------
              --------------->AGL15                    <---------ZAT2 --------->ZAT2   <---------ARR11(3)
              <---------------AGL15            --------->ALFIN1  <---------bZIP60(1)   --------->GATA12
              --------->TOE2(3)  ---------->DOF2<---------MYB46(3)   ------>NtERF2     --------->ARR11(3)
  ---------->DOF2  ---------->DOF2 --------->DOF5.7(1)--------->ARR11(3)   --------->RAP2.6(3)
==============================MADS_MADS   <<<<<<<<<<<<<<<<<LFY --------->YAB5------>NtERF2<---------HSFB2a(2)
 
ataagaaaagtttcaaactttaaaaagcaaagagaagaaagaagagaccagtggtgagagcttggatgatgccagctcgacggcccttaaaatctcgaaa  6942800
                               --------->ARR14(2)
                               --------->ARR11(2)
                               <---------ARR14(2)
                               <---------ARR11(2)
                              --------->GLK1(1)
                             ----------->ARR10                          ---------->DOF2
                           --------->ZAT18                            <---------YAB1
                           <---------ZAT18                      --------->ARR11(2)
                         --------->ZAT18                        <---------ARR11(2)
                         <---------ZAT18                        <---------ARR14(2)             <----
                         --------->ZAT14                        --------->ARR14(2)            <-----
                    <---------ZAT14   ------>ZmHOX2a(1)     <---------LBD16                  <------
    ----------->HVH21    <---------ZAT14         <---------CCA1(2)  --------->YAB5        <---------ANAC58
--------->KAN1      --------->ZAT14 <---------DOF5.7(1) ------>ZmHOX2a(1)                 <---------ANAC58
--->DOF2           <----------DOF2 ------>ZmHOX2a(1)  <-----------------AGL1       <---------TOE2(3)
 
gacttcttcgacagttcgagggctgtagtgcgcagttcctccttccatgtccgtctctcctctctcggaaacgatgaaagaacagtgaggtttgcttctt  6942900
                                                                                     -------->P
                                                                                     ------>MYB46(1)
                                                                                     ------>MYB83
                                                                         ----------->HVH21
                                                                         --------->REM1(2)
                                                                         --------->ETT(2)
                                                                         <---------ETT(2)
                                                                       <-------PIF5--------->MYB46(3)
                                                                       --------->LBD16
                                                                       ------->PIF5----------->HVH21
                                             --------->TOE2(3)        <---------O2 <---------MYB59
      ---------->DOF2      --------->ANAC55(2)                        <---------ANAC46   --------->LBD16
-----DOF5.7(1) <---------KAN1      ----------->GT1           --------->DAG2        --------->DEAR3(1)
-----DOF2*TSS  --------->AHL12(1) --------->DAG2            ---------->DOF2    ----------->HVH21 <--
---DOF5.7(1) <---------GLK1(2)   ---------->DOF2---------->DOF2       --------->O2--------->DEAR3(2)
 
ttttttttctaaagcagaatttttgttcttaagtgataaagtaagaaaacttaatgcagactaaaaagttgccccgtggacagtgaccgacccggtctag  6943000
                        <---------ANAC55(2)
                       <-------TEIL                               <---------ANAC46
                  --------->AHL12(3)                              <---------ANAC58
                  --------->AHL20(2)                              <------MYB83
                  --------->AHL25(2)                              <---------ANAC58
                  --------->AHL20(3)                     <----------DOF2
                  <---------AHL12(3)                    <---------ANAC46
                  <---------AHL20(3)                    <---------ANAC58
                 <---------AHL25(3)         <---------ICU4        <------MYB46(1)
                 --------->YAB1             --------->YAB1       <---------AtMYB61
                --------->AHL20(2)       --------->YAB1 <---------ANAC58
          <---------AHL20(2)   --------->MYB52(1)      <---------TOE1(2)
          --------->AHL20(2)  <---------AHL20(2)    <---------ANAC58
        --------->WOX13(2)    <---------ATHB51      <---------ANAC58<---------ZAT6
        <---------WOX13(2)  --------->AHL12(2) --------->ARR11(3)--------->MYB111(2)
---------GT1  --------->YAB1--------->YAB1<---------AHL12(2)     --------->MYB46(2)   --------->YAB1
 
tcacaacacttatttaaaaataaaaatacataaataatggacattaataatgtcttcgtgcgtttagtttggtgttatctcattttcaaacataatcaag  6943100
                                                 --------->ANAC58
                                      <---------YAB1
                                   <---------YAB1<---------ANAC55(2)
                                  --------->AHL20(3)
                                  <---------AHL25(2)
                                  <---------AHL12(2)      <---------ALFIN1
                                  --------->AHL25(2)   <---------ICU4
                                  --------->AHL20(1)   --------->YAB1
                                  <---------AHL20(3)  <---------YAB5            <-----------GT1
   <------NtERF2                 <---------ICU4  --------->ANAC55(1)       --------->YAB1         <-
   ----------->GT1               --------->AHL12(1)--------->TGA2(2)      <---------YAB5          <-
  --------->HSFB2a(2)           --------->ICU4   --------->ANAC58       --------->YAB1            <-
  <---------HSFB2a(2)          --------->AHL12(3)--------->ANAC46      <---------AHL20(2)      <----
 --------->ETT(1)              --------->AHL12(2)--------->ANAC55(2) --------->CCA1(2)       <------
 <---------ANAC46       --------->GLK1(1) ----------->HVH21         --------->ARR11(3)    <---------DOF5.7(1)
 <---------LBD16       <---------GATA12  <---------WOX13(1)         <---------ARR11(3)   <----------DOF2
 
tttgtcgggaaaaaaactactctacagatttcataaatattatgaatgacagacgtaatcaacacattcaagatataatcatataaccatgtcttttttc  6943200
                                                                                  <---------AHL12(2)
                                                                                --------->AHL25(2)
                                                                   ----------->RAV1(1)
                               --------->LBD16     <---------At4g35610          --------->AHL25(1)
                         <---------YAB5            --------->At4g35610          --------->AHL20(2)
                 --------->ANAC58  <------ZmHOX2a(1)             ------>MYB83   <---------AHL20(3)
       <---------ATHB12 <---------ARR11(3)      <------ZmHOX2a(2)------>MYB46(1)--------->AHL12(3)
       <---------YAB5   --------->ARR11(3)   <---------YAB1     ----------->RAV1(1)
     --------->WOX13(1)--------->YAB1       <-----------------------TaNAC69(2)  --------->AHL20(3)
--------DAG2     <xxxxxxxxxxxxxxxxxxsmallRNA(se3)==============================RAV--------->AHL12(2)
---------DOF2  ---------->DOF2<---------HSFB2a(2)===========================RAV--------->AHL12(2)---
--------DOF5.7(1)--------->ANAC58  ====================HOX2a_HOX2a--------->MYB46(3)           -----
-------GT1--------->At4g35610 --------->HSFB2a(2)<-----------RAV1(2)      ----------->GT1      -----
-----GT1--------->YAB1--------->ICU4       <-----------GT1     --------->AtMYB61<---------AHL12(3)
 
acttttctcaatcatctacaaagccatgatcatccagaggaaatagttacgatcagatgagaaacaccaacaacaattggaaaaaaaataacccaaaaaa  6943300
                                                                  --------->At4g35610
                                                              <---------ARR11(2)
                             --------->YAB5                   --------->ARR11(2)         <---------ARR11(3)
                          <---------At4g35610                 <---------ARR14(2)         --------->ARR11(3)
                          --------->At4g35610                 --------->ARR14(2)         <----------
                         <---------GATA12        --------->RVE1(2)<---------At4g35610    --------->RVE1(2)
                         ------->TEIL  --------->ZAT6    <---------ZAT2                 <---------KAN1
------>DOF5.7(1)       <-------TEIL<---------ANAC58      --------->STY1(2)       ------>ZmHOX2a(1)
---->DOF5.7(1)  --------->ANAC58   <---------ANAC58      --------->ZAT2  ---------->DOF2<---------CCA1(2)
----->DOF2      --------->ANAC58  --------->At4g35610    <---------STY1(2)   --------->ARR11(3)
 
aagaaggaaaactgagacgaagcaaatgcatctgattagcttacacttgccatctccactagctggttctgcttacaaaagttcctgtccaatatctcac  6943400
<- Previous    Next ->

AGI:  At5g20510.1   
Description:  PHD finger family protein. similar to PHD finger family protein [Arabidopsis thaliana] (TAIR:AT3G42790.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO45651.1); contains InterPro domain Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); contains InterPro domain Zinc finger, PHD-type; (InterPro:IPR001965); contains InterPro domain Zinc finger, FYVE/PHD-type; (InterPro:IPR011011)
Range:  from: 6939815    to: 6942910    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At5g20520.1   
Description:  WAV2 (WAVY GROWTH 2). similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G13610.1); similar to unknown [Populus trichocarpa] (GB:ABK94077.1); contains InterPro domain Alpha/beta hydrolase fold-1 (InterPro:IPR000073)
Range:  from: 6943156    to: 6946456    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version