AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                               --------->GATA12
                                                      --------->At4g35610
                                                      <---------At4g35610
                                                    <-----------RAV1(2)
                                                   <---------ZAT2
                                                   --------->At4g35610
                                                   <---------At4g35610
                                       <---------DOF5.7(2)     --------->RVE1(2)
                                      <---------WRKY45--------->ZAT2   <----------DOF2
        --------->DOF5.7(1)           <---------WRKY12<---------ZAT2  <---------DOF5.7(1)        ---
      ---------->DOF2                 <---------WRKY38(1)     <---------CCA1(2)                 ----
---------DOF2           <---------DOF5.7(2) <-------TEIL  <-----------HVH21   <---------REM1(2) <---
--------DOF2          --------->DOF5.7(2) <---------SPL7(1) <---------WRKY38(1)    <---------ALFIN1
-------DOF5.7(1)<----------DOF2      --------->WRKY18(1) ----------->GT1      --------->ZAT14-------
 
cctttgggagaaagatgggctttgcgataacgatttcaaggtcaacgtacagacagcagctggtcaaatctcttctttctcttcacacactggcagtgag  4501000
                                   --------->GLK1(2)
                                 --------->KAN1
                              ------->GAMYB
                      <---------AHL12(1)
                     <---------AHL12(3)
                     --------->AHL12(3)
                     --------->AHL25(2)
                     --------->AHL12(1)
                     <---------AHL12(1)
                     <---------AHL25(3)
                     <---------AHL12(2)
                    --------->AHL12(3)
                    <---------AHL12(3)
                    <---------AHL12(1)
                    --------->AHL25(1)                                              <---------KAN1
                    <---------AHL20(2)                                             --------->ARR14(2)
                    <---------AHL25(1)                                             <---------ARR14(2)
                    --------->AHL20(2)                                <---------ARR11(3)
                    <---------AHL25(3)                                --------->ARR11(3)
                    --------->AHL25(3)                                --------->GLK1(2)
                   <---------AHL12(3)                              <---------AHL20(2)
                   --------->AHL25(2)                              --------->AHL12(3)
                   <---------AHL25(1)                        <---------KAN1 --------->YAB5
      <---------YAB1<---------AHL25(2)                      --------->GLK1(2)      --------->GLK1(2)
 --------->ANAC55(2)--------->AHL12(1)                      --------->RVE1(2)      --------->GATA12
 <---------ANAC55(2)--------->AHL25(2)                     <---------GLK1(2)--------->ATHB12
<-------TEIL       --------->AHL25(1)                --------->ATHB12--------->RVE1(1)
-------->GT1       --------->AHL12(3)                --------->YAB5--------->AHL20(3)
----------->AtSPL8 --------->AHL20(2)          --------->ARR11(3)  <---------AHL20(3)          <----
------------AtSPL8 <---------AHL25(2)          --------->GLK1(2)   <---------AHL25(1)   <---------MYB52(1)
-->ATHB12          --------->AHL25(3)          <---------ARR11(3) --------->YAB1  <---------GLK1(2)
 
tggtacataattcttgaacaaaaaaaatttcaaccgagattccatagaaaaatctttgattagaatctataaaaatctttgattagaatctgttaagtct  4501100
                                                                                       --------->GLK1(2)
                                                                                 <---------WOX13(2)
                                                                                 --------->WOX13(2)
                          ------>ZmHOX2a(1)                                     ----------->GT1
                         --------->TOE2(3)                                <----------DOF2        <--
                       ------>ZmHOX2a(1)  <---------YAB1            --------->ANAC58   --------->RVE1(2)
                    <---------YAB5     <---------YAB5               --------->ANAC46   --------->GATA12
------DOF2    --------->ZAT6         <---------CCA1(2)              --------->ANAC58   --------->ARR11(3)
 
ttaaaaaactcaaactctcactaatcctccttaaatttgtgtatcattttagttttgaaaaaccatggaataggcaacttttgtagttaaaatctgtttc  4501200
                      <---------AGP1
                      --------->AGP1
                      <---------ARR11(3)
                      <---------RVE1(2)
                      --------->GATA12
                      --------->ARR14(2)
                      <---------ARR11(2)
                      --------->ARR11(2)
                      <---------GATA12
                      --------->ARR11(3)
                      <---------ARR14(2)
                      --------->RVE1(2)
                      <---------ARR14(3)
                    ----------->ARR10
                  <---------At4g35610
           --------->ARR11(2)                        --------->LBD16
         --------->LBD16  <-----------HVH21        <---------LBD16
        --------->HSFB2a(2)                   <---------GLK1(1)                                 ----
        <---------HSFB2a(2)                   --------->GLK1(1)                                 <---
       <---------LBD16--------->ARR14(3)  ------>ZmHOX2a(2)                                   <-----
     --------->ARR14(2)  <----------DOF2 <---------At4g35610       <---------RVE1(2)     <---------AHL25(2)
     <---------ARR14(2) ------>ZmHOX2a(2)--------->At4g35610 --------->RVE1(1)           --------->AHL12(1)
     <---------ARR11(2)<------ZmHOX2a(2)<---------GATA12    --------->GLK1(2)            <---------AHL12(1)
    <---------KAN1--------->LBD16   --------->ANAC55(2)     --------->ARR11(3)         --------->AHL12(2)
    <---------GLK1(1)<---------CCA1(2)  <---------RVE1(2)   <---------ARR11(3)       >>>>>>>>>GT-1<-
--------DOF2--------->GLK1(1)       <---------ANAC55(2)     --------->RVE1(2)     ----------->GT1 --
 
cttttgaatttccggaaataccgcagatctttcacagataagtgatctgatttctcagggaaaaatctctgatttgatttcaacatggttaatatttctt  4501300
 <---------AHL20(2)
 --------->AHL20(1)
 <---------AHL20(1)
 --------->AHL25(2)
 --------->AHL20(2)                       <---------AHL25(1)
 --------->AHL12(1)                       --------->ATHB51
 --------->AHL25(1)                       <---------AHL20(2)
 <---------AHL25(1)                       <---------AHL12(1)
 <---------AHL25(2)                       --------->AHL20(2)
 <---------AHL12(1)                       --------->AHL25(1)
 <---------AHL25(3)                       <---------AHL25(3)
--------->AHL12(1)                        <---------AHL12(3)
<---------AHL12(1)                        --------->AHL12(1)
--------->AHL12(3)                       <---------YAB5
--------->AHL20(2)                       <---------AHL12(1)
--------->AHL25(3)                       --------->AHL25(3)                             <----------ID1
<---------AHL20(2)                       --------->AHL12(1)                          --------->DOF5.7(1)
<---------AHL12(3)                ----------->RAV1(1)                              ---------->DOF2
<---------AHL25(1)               ----------->HVH21                             ---------->DOF2     -
--------->AHL25(1)               <---------ETT(1)                            <------NtERF2         <
----->AHL20(2)                  ========================HOX2a_HOX2a        <---------LBD16         -
------AHL20(2)                  ------>ZmHOX2a(2)             --------->DAG2--------->LBD16        <
-----DOF2      ---------->DOF2<---------RVE1(2)              ---------->DOF2------>NtERF2          -
--------WOX13(2)              <---------GATA12         <---------ARR11(2)  --------->LBD16        --
------->WOX13(2)             --------->KAN1      <------ZmHOX2a(1)        <---------LBD16<------ZmHOX2a(1)
 
taaataaattgggccttagaaagcccatccattgatccgacagaattatttaggagggaaaccgaaaagttgaaatcgccgggaaagaaagaggacaaac  4501400
                                           --------->YAB1
                                           <---------ICU4
                                          <---------YAB5
                                         <---------WOX13(2)
                                         <---------AHL12(2)
                                         --------->WOX13(2)
                                        <---------AHL25(3)
                                       --------->AHL12(1)
                                       <---------AHL25(3)
                                       --------->AHL25(3)
                                       --------->AHL25(1)
                                       <---------AHL12(3)
             <----------DOF2           <---------AHL20(2)
    <---------ANAC55(1)                <---------AHL25(2)
    --------->ANAC55(2)                --------->AHL20(1)
    <---------ANAC58                   --------->AHL20(2)
    <---------ANAC58                   <---------AHL25(1)
    <---------ANAC55(2)                --------->AHL20(3)           <---------AHL12(2)
    <---------ANAC46                   --------->AHL25(2)    ----------->GT1
-------->AHL20(2)                      <---------AHL12(1)   <------ZmHOX2a(1)
---------AHL20(2)               ---------->DOF2            ----------->GT1
-------->AHL25(1)               --------->DOF5.7(1)    --------->DOF5.7(1)
---------AHL25(1)           <---------AHL25(3)        ---------->DOF2                      <--------
-------->AHL12(3)           --------->AHL20(2)  *TSS  --------->DOF5.7(1)                  <--------
------->AHL25(3)  ------>ZmHOX2a(1)   --------->AHL25(3)--------->DOF5.7(1)          ---------->ID1
 
atttatttcgtgtctactttcctccttgaaataaaaaaagaattaattataccaaaaaaaagaggagaaaaaaaaaactctcatcttcgtcgtcttcaca  4501500
                                                     --------->LBD16
                          <---------ANAC58           <---------------AtSPL3                      ---
                          <---------ANAC58<---------MYB52(1)                                     ---
                       ------>ZmHOX2a(1)--------->ANAC46                                    <-------
             ----------------------->TaNAC69(2)<---------DAG2                               --------
            <---------At4g35610        <---------LBD16   <-------TEIL                       --------
-ZAT14      --------->At4g35610<------------------------ANAC81                    <---------ICU4----
-REM1(2) <---------At4g35610<---------CCA1(2)  <----------DOF2                    --------->ARR14(2)
 
gtttcaatctcgcgctgcttagtctccttccgtctcttcttctccgctagcttttccaggtacgtctgtctctctaacctctcaatatttgcccatttcc  4501600
                                       <---------MYB46(3)
                                       <-----------RAV1(1)
                                    <---------DOF5.7(1)                        <---------YAB5
            <---------MYB52(1)      <----------DOF2                        --------->DOF5.7(1)  ----
------>TOE1(1)<---------ANAC58 <---------ARR11(2)                        ---------->DOF2        ----
------>ANAC46 --------->MYB52(2)   <---------DOF5.7(1)             --------->LBD16             -----
--ARR14(2)<---------ANAC58     --------->TCP20                    <---------LBD16        <---------ANAC46
->ARR11(2)<---------ANAC58  --------->HSFB2a(2)<---------KAN1    <-----------RAV1(2)   <---------MYB46(3)
->ARR14(2)<---------ANAC46 <---------LBD16    <---------GLK1(1)  <---------LBD16   ------>ZmHOX2a(2)
-->ZmHOX2a(1) <---------ANAC58 --------->ARR11(2)    <---------TOE1(2)   --------->DOF5.7(1)   -----
 
tcgtaatactgttccgttcgtgtctcgatttgtggaacccttttgttggaatttcgagggttttgttttcaggggaaaaagagtgatcgatggctggaaa  4501700
                                                  <-------TEIL
                                          <---------ZAT14
                                         <---------ZAT6
                                         --------->ALFIN1
                                   --------->GATA12
                       --------->MYB52(1)<---------KAN1                                <------NtERF2
                       ------>MYB83--------->ARR11(3)                                 ------>NtERF2
                 ----------->HVH21 <---------GATA12                                  <---------ANAC46
--------->ARR11(2)     ------>MYB46(1)  >>>>>>>>>TAC1                      <---------At4g35610
<---------ARR11(2)   <---------MYB59<------ZmHOX2a(2)                      --------->At4g35610
----->DOF5.7(1)  ------>ZmHOX2a(1) --------->ARR14(2)                     --------->MYB52(2)       <
----->DAG2       ==========================HOX2a_HOX2a            ---------->DOF2 --------->DOF5.7(1)
----->DOF2     <---------At4g35610 <---------ARR11(3)  --------->DAG2   <---------MYB52(1)      <---
---->DOF5.7(1) ----------->RAV1(2) <---------ARR14(2) ---------->DOF2  <-----------HVH21<----------DOF2
 
aaggaaacgagctaatgctcctgaccaaacagagcgaagatcgagtgttcgggttcagaaagtgagacagaaagcgttagatgagaaggcgcgtttagta  4501800
                                                                          <------ZmHOX2a(1)
                            --------->DAG2                              ----------->GT1
          <---------At4g35610----------->GT1                       --------->DOF5.7(1)
     <-------GAMYB         --------->DOF5.7(1)             <---------ANAC55(2)
    ----------->GT1      ---------->DOF2                   --------->ANAC55(2)
------ZmHOX2a(1)   ----------->HVH21                      <-------TEIL--------->DOF5.7(1)
--------RAV1(2)------>ZmHOX2a(1)              ----------->HVH21  ---------->DOF2  --------->ETT(2)
 
caggagagggttaagctcctcagtgacagaaagagtgaaatttgtgtcgatgacactgagttacatgagaaagaagaggaaaatgtcgatgggagcccta  4501900
<- Previous    Next ->

AGI:  At5g13960.1   
Description:  SUVH4 (SU(VAR)3-9 HOMOLOG 4). Identical to Histone-lysine N-methyltransferase, H3 lysine-9 specific SUVH4 (SUVH4) [Arabidopsis Thaliana] (GB:Q8GZB6;GB:Q9C5P3;GB:Q9FFX9); similar to SUVH5 (SU(VAR)3-9 HOMOLOG 5) [Arabidopsis thaliana] (TAIR:AT2G35160.1); similar to SUVH6 (SU(VAR)3-9 HOMOLOG 6) [Arabidopsis thaliana] (TAIR:AT2G22740.2); similar to SUVH6 (SU(VAR)3-9 HOMOLOG 6) [Arabidopsis thaliana] (TAIR:AT2G22740.1); similar to putative SUVH4 [Oryza sativa (japonica cultivar-group)] (GB:BAB89674.1); similar to Os01g0927000 [Oryza sativa (japonica cultivar-group)] (GB:NP_001045266.1); contains InterPro domain Pre-SET zinc-binding region; (Inter
Range:  from: 4501449    to: 4506190    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version