AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
   <---------ZAT14
   --------->At4g35610                       --------->LBD16
   <---------At4g35610                      <---------HSFB2a(2)
<---------ANAC58                            --------->HSFB2a(2)
<---------ANAC58                          --------->CCA1(2)
----YAB1                                 <---------GATA12
----TOE2(3)                              --------->GATA12
---AHL12(2)                              --------->ARR11(2)
-->AHL25(2)                              <---------ARR14(2)
---AHL25(2)                              <---------ARR11(2)
---AHL25(3)                              --------->ARR14(2)
-->AHL12(2)                              --------->AGP1
-->AHL12(3)              ========================HOX2a_HOX2a
---AHL12(3)              <------ZmHOX2a(1)<------ZmHOX2a(2)
--AHL20(2)      <-----------------AGL1   <---------ARR11(3)
--AHL25(3)      ----------------->AGL1   --------->ARR11(3)
->AHL25(1)      --------->At4g35610     --------->GLK1(1)      <-------TEIL
>AHL25(3)    ----------->HVH21 --------->AtMYB61       <---------O2      <---------At4g35610 <------
 
attgagtgctgagtctctgacctgaacaggaagaccaaaaccgagatccagaagacagacttggcatacattttttagcttagagcaagtttgacaaatc  2195500
                                                                             <---------YAB1
                                                                             <---------YAB5
                                                                            <<<<<<<<<<GATA-4
                                                                            <<<<<<<<<<GATA-1
                                 ------>NtERF2                              <<<<<<<<<<GATA-2
                                --------->DEAR3(1)                          <<<<<<<<<<GATA-3
                                <---------ALFIN1                          ------>ZmHOX2a(1)
                               <------NtERF2                    <---------ANAC58
                               --------->ATERF1(1)              <---------ANAC58
                      ------>NtERF2                           <---------ARR14(2)
                     --------->LBD16                          --------->ARR11(3)
                    <---------RAP2.6(2)            <------ZmHOX2a(1)     <---------ANAC58
                   <---------LBD16             ---------->DOF2--------->ARR14(2)
                   --------->RAP2.6(3)---------->DOF2        <---------CCA1(2)--------->YAB1
         --------->GATA12     <---------ATERF1(1) --------->DOF5.7(1)    --------->TOE2(3)
         <---------GATA12  <-----------HVH21 ----------->HVH21<---------ARR11(3)
---GATA12------->TEIL------>NtERF2 --------->TOE2(3)  --------->YAB5     <---------ANAC58   --------
 
tcggttttcttgaatctagcattccggcctggtcgccacctaaaagctgtgaaaggacgactacatatcttgcattccttatcataatccgctcgggtct  2195600
                                                 --------->ANAC46
                      <---------GATA12           --------->ANAC58
                      <---------ARR14(2)         --------->ANAC58
                      --------->ARR14(2)      --------->ZAT14
                     <------ZmHOX2a(1)   --------->ZAT18     --------->YAB5                  -------
                  --------->YAB1         --------->ZAT14     -------->ATHB1                  -------
                  <---------ICU4         <---------ZAT14     --------->YAB1                  <------
                <---------WOX13(2)       <-------TEIL        <--------HAHB4            --------->TOE1(3)
                --------->WOX13(2)     <-------MYC3          <---------ICU4     <----------DOF2
               --------->YAB1          ------->MYC2         <---------YAB5      --------->TOE2(3)  <
            --------->TOE2(3)          <-------MYC2         --------->ICU4--------->YAB1   ------->TEIL
            --------------->AGL15  --------->DOF5.7(1) --------->YAB1   ------>MYB46(1)--------->TOE2(3)
            <----------DOF2    ----------->GT1<---------ZAT18--------->ATHB12   --------->TOE1(3)  -
   --------->ANAC46<---------TOE2(3)   ------->MYC3 --------->CCA1(2)   ------>MYB83  ----------->RAV1(2)
->GATA12--------->MYB46(3)    >>>>>>>>>TBF1<---------ANAC46--------->GLK1(2) <---------ARR11(3)    -
 
acatataaacaacaactttaataaggatttgaagaagaaaaacgtgcagtgcaagctatgagaatcattagcacctacaataactttaaacctgaaccta  2195700
                                                                                           <--------
                                                                                        --------->ARR14(2)
                                                                                        <---------ARR14(2)
   <---------WOX13(2)                                                               <---------LBD16
   --------->WOX13(2)                                                               ------->TEIL
-->TOE2(3)                --------->ZAT14                                        <---------KAN1    -
-->TOE1(3) --------->WOX13(2)                                                   <---------TOE1(2)  -
---MYB59   <---------WOX13(2)                                                  <------------------SPL14
---------MYB59            <---------ZAT14                             <-----------GT1   --------->ARR11(2)
-------->TOE1(3)     --------->ZAT18       ---------->DOF2    ----------->GT1  <---------AtLEC2 ----
-------->TOE2(3)--------->MYB46(3)   --------->TOE2(3)--------->CCA1(2) <---------YAB1  <---------GLK1(2)
 
aacctaaattactaagttaacaactccactatacagaaaacatcaacaaagcttaagagatgggagcgagaaatcaccattcgcatgtacggattgtcac  2195800
            <---------At4g35610
            --------->At4g35610
            <---------ZAT2
           <---------TOE1(2)
           <---------TOE2(2)
       <-------TEIL
      --------->ARR14(1)
      --------->CCA1(2)                                                                            -
     <---------GATA12                                                                              <
     --------->GATA12           <----------DOF2                                                    -
     --------->ARR11(1)       ------>NtERF2                                                        -
     <---------ARR11(2)   <---------DEAR3(1)                                                    ----
     <---------GLK1(2)  <---------GATA12                                                        ----
     --------->ARR14(2) --------->ARR14(2)                                                    ------
     <---------ARR14(2) --------->GATA12                                                      <-----
     --------->ARR11(2) <---------ARR14(2)                                                    ------
    --------->KAN1     <---------GLK1(1)                                                      <-----
   ----------->ARR10   --------->GLK1(1)                ------>ZmHOX2a(2)                   <-------
---HVH21  <-----------RAV1(2) --------->ABI4(2) ------>NtERF2                            --------->WOX13(1)
-------->ANAC58  <---------WOX13(1)           --------->At4g35610                      ------------>CBF
-------->ANAC58<---------MYB46(3)       --------->MYB46(3)  <-----------HVH21       <---------ARR11(3)
----->DEAR3(1) --------->ATHB12<---------DOF5.7(1)    <---------ARR11(3)            --------->ARR11(3)
 
cgaagcaagattcgcaggtgattgggaaatcggcgctttcccatccatcggctccatgatccctgtgagacattttcttcggtactagatatcaatctcg  2195900
                                                                       <------------CBF
                                                                      --------->ATHB51
                                                                      <---------ICU4
                                                                      --------->ATHB12
                                                                      <--------ATHB1
     ==============================================================================MADS_MADS
     --------------->AGL15                                           <<<<<<<<<<AGL20
     <---------------AGL15                                           <<<<<<<<<<AGL24
     <----------DOF2                                                 <<<<<<<<<<AGL22
    <-----------------AGL1                                           <---------ATHB51
-------->ANAC58                                                      --------->ICU4
---------bZIP60(1)                                                   <---------ATHB12
-------->ANAC58                                                      <---------YAB1             <---
-------->bZIP60(1)                                               ----------------->AGL3         <---
------->HVH21                                                    ------------>CBF              -----
------->TGA1<----------ID1                                  <---------ZAT6                  <-------GAMYB
--->O2 <---------YAB1                                      <---------TOE2(3)             <----------
----ANAC55(2)                                              <---------TOE1(3)  <----------DOF2<------
--->ANAC55(2)   ---------->DOF2      <---------KAN1     <<<<<<<<<MYB98-------->ATHB1    <---------PCF2
----O2<-----------TBP    --------->RVE1(2)        --------->CCA1(2)--------->WOX13(1)   --------->PCF5
------DYT1  --------->ANAC46 <---------RVE1(2)  <---------AHL20(3)------------>ATHB5    --------->PCF2
 
tgacgctacttttataggccaaagtccaaatcgatttggaatttctcttaaaaatatgggttagggttaccaattattgggctttaaactgggcccgtta  2196000
                                <---------ZAT14
                                --------->ZAT14
                              <---------At4g35610
                       <---------ARR14(3)
                       --------->ARR14(3)
     --------->YAB1    --------->ARR11(3)
   --------->ANAC58    --------->RVE1(2)
   --------->ANAC58    --------->GATA12                         --------->YAB1                     <
------TOE2(3)          <---------ARR11(3)                    --------->YAB1                      <--
------TOE1(3)          --------->GLK1(2)                  --------->YAB1                     ------>ZmHOX2a(1)
----->DOF2<---------TOE2(3)   --------->At4g35610   ------------>CBF                     --------->ARR11(3)
-------AGL1            --------->ARR14(2)<---------ANAC55(2) <---------ICU4 <----------DOF2  -------
---MYB52(1)        --------->YAB1        --------->ANAC55(2)<---------YAB5------->TEIL  --------->KAN1
 
aggctcaagcattaagaaactttcaaaatcttcagcacacagacacataatagtctacaattcatcatcaaaatacgaactttgatttcaaaaatcctga  2196100
                                                                                                   <
                                                                                                   -
                                                                                                ----
                                                                                               -----
                                                                                           <--------
                                                                                          --------->MYB52(1)
                                                                            --------->ANAC58 -------
                                               <-------TEIL                 --------->ANAC46--------
                            --------->DAG2   --------->GATA12      --------->YAB1        --------->ARR14(2)
                            <---------------AtSPL8                <---------ATHB12       --------->ARR11(2)
                            --------------->AtSPL8              --------->WOX13(1)       <---------ARR11(2)
                            --------------->AtSPL3            ------------>CBF           <---------ARR14(2)
                 --------->ATHB12       ------>ZmHOX2a(1)   --------->WOX13(1)       ---------->DOF2
------------CBF  --------->YAB5       <---------DOF5.7(1)  --------->MYB46(3)      --------->AHL20(2)
-------YAB5   <------------CBF      <---------ALFIN1      ------------>CBF  --------->ANAC58<-------
-->LBD16  <------ZmHOX2a(1)---------->DOF2   <---------GATA12 <---------ATHB12     <---------AHL20(2)
 
aacattgttaacaggaacattgattagtagaaaagtacccctccttcagattcaaagtttcaacaatcaatcaacacagacgacatttaaaagaaccggg  2196200
                       --------->YAB5
                  <---------AHL25(1)                                                   <---------WOX13(1)
                  <---------AHL20(3)                                                  --------->WOX13(2)
                  <---------AHL12(3)                           <----------DOF2        <---------WOX13(2)
---------ARR11(3) <---------AHL20(2)                           --------------------->WRI1   --------
-------->ARR11(3) --------->AHL20(2)                    ------>ZmHOX2a(2)          <---------MYB52(1)
-->NtERF2         --------->AHL25(1)                  <---------ARR11(3)          <-------GAMYB
------>HVH21  <------ZmHOX2a(1)                       --------->ARR11(3)         <---------DEAR3(2)
-LBD16      <---------TOE1(2)                         <---------RVE1(2)          ----------->GT1
-->LBD16    <---------TOE2(2)                         --------->GATA12           <------MYB46(1)
->TOE1(2)   <---------TOE2(3)               <-----------GT1   <---------DOF5.7(1)<------MYB83
--LBD16  <---------DOF5.7(1)  --------->MYB46(3)  <----------DOF2                <---------MYB46(3)
 
gacatcttagcctcttaggatttaaatgtttcaacaactccttgatttttcttctttgatcttcttctttttgagtttcttagtcggttaattgacaaag  2196300
                   <---------WOX13(1)
                 --------->YAB5
                 <---------ICU4
                 --------->YAB1
                 --------->ATHB12
                 -------->HAHB4
                 <--------ATHB1
                <---------YAB5
                <---------YAB1
                <---------ATHB12
                --------->ICU4
              --------->YAB1                                       --------->DOF5.7(1)       <------
          --------->ZAT6                                         ---------->DOF2   ----------->GT1
         <---------ATHB12            --------->YAB5          <-------TEIL         ----------->GT1
-->DOF2------>ZmHOX2a(1) ----------->GT1                    ------------------------>ANAC81---------
 
ttgttatgtcctatcagtaatgattgtccagtaatacatatgagtattgaaacagagtttaagatgcaaaaagactagatggaaactggaaaaatagtta  2196400
<- Previous    Next ->

AGI:  At5g07060.1   
Description:  zinc finger (CCCH-type) family protein. similar to zinc finger (CCCH-type) family protein / RNA recognition motif (RRM)-containing protein [Arabidopsis thaliana] (TAIR:AT1G07360.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO21518.1); contains InterPro domain Zinc finger, CCCH-type; (InterPro:IPR000571); contains InterPro domain RNA recognition motif, RNP-1; (InterPro:IPR000504)
Range:  from: 2194395    to: 2195873    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version