AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                          <---------WOX13(1)
                                                                                     --------->GLK1(1)
                                                                                     <---------GLK1(1)
                                                                                    --------->ARR14(2)
                                                                          <---------------AGL15
                                                                          --------------->AGL15
                                                                          --------->TOE2(3)
                                                                          <---------DAG2 <---------ANAC58
              =====================bZIP_DOF                               --------->TOE1(3)---------
              <----------DOF2                                            ----------------->AG     --
          <---------ZAT14                                              <-----------GT1   <---------ANAC58
         <---------ZAT6  <---------O2                             <---------ARR11(3)--------->ARR11(2)
       <---------ANAC46  --------->O2                             --------->ARR11(3)<---------ARR14(2)
       <---------ANAC58  --------->TGA1a                    ----------->GT1         <---------ARR11(2)
       <---------ANAC58  <---------TGA1a   <---------MYB52(1)<---------SPL7(1)     <------ZmHOX2a(1)
 
catcgaaatggagtgttctttttggctcacttgagttccatagtcccttgttttctgatcaggtcgtaagaacttaaccttatggaggaaatgcttgaca  16532600
                                                <---------ZAT14
                                            <---------ICU4
                                           <---------YAB1
                                           <---------YAB5
                                        <---------AHL20(2)
                                   ------>ZmHOX2a(2)
                                   <-------TEIL --------->ZAT14
                                  <------ZmHOX2a(2)
                                 <---------ARR11(3)
                                 <---------ARR14(2)                                            -----
                                 --------->ARR14(2)                                      --------->ARR14(2)
                                 --------->ARR11(2)                                      --------->ARR11(3)
                                 --------->RVE1(2)                                <---------ANAC46
                                 --------->GATA12                                 <---------ANAC58
      <---------GATA12           <---------GATA12                                 <---------ANAC58<-
-->HVH21<-------TEIL             <---------ARR11(2)                   <---------ARR11(3) <---------ARR14(2)
-------->DOF2                   <------ZmHOX2a(1)                     --------->ARR11(3)<---------KAN1
 
ttaaagacagattcaaaaacaattgaaacagagcaggatccatataatcagtgtattgctaagaaacatgtaagatttcaacatgtcttgaatatatggt  16532700
               <---------GATA12
              <---------At4g35610
        --------->YAB1
        --------->ATHB51
        <---------ICU4
       <---------ATHB51   --------->RVE1(2)                                                     ----
       <---------ATHB12   <---------ARR14(2)                                                    ----
       --------->ICU4     --------->ARR14(2)                                         <---------ANAC46
      --------->WOX13(2)  --------->GATA12                                       --------->WOX13(2)
  --------->ANAC58  --------->ANAC46                                             <---------WOX13(2)
  --------->ANAC58  --------->ANAC58            --------->DOF5.7(1)            <---------AHL20(2)
  --------->AtLEC2  --------->ANAC58          ---------->DOF2           --------->YAB5<---------LBD16
<---------AtLEC2 <-------TEIL                 --------->DOF5.7(1)      --------->DOF5.7(1)      ----
---->ARR11(2) --------->At4g35610   ----------->RAV1(1)            <---------AHL25(3)----------->RAV1(2)
--------YAB1 <---------RVE1(2)     <----------ID1            ----------->GT1----------->GT1   <-----
 
tatgcatgcaattatggagatgcaagccaaatccatagacaacaaaaaaaaaagaagaattgtatagaaataaaaagattagtaaattacctggaaacca  16532800
                                                                                        ---------->DOF2
                                                                                    --------->TOE2(3)
                                                                                  --------->ARR11(3)
                                                                                  <---------ARR11(3)
                                                                                 <---------GLK1(1)
                                                   <---------AHL12(2)            <---------CCA1(2)
                                                   --------->AHL12(2)     <---------AHL25(2)
                                                  <---------AHL25(3)      --------->AHL25(2)
                                                 --------->AHL25(1)       --------->AHL25(1)
                                   --------->ARR14(3)                     <---------AHL20(3)
                                   <---------ARR14(3)                     --------->AHL20(3)
                                   <---------ARR11(3)                     <---------AHL20(2)
-->MYB83<---------YAB1             --------->ARR11(3)                     <---------AHL25(1)
----->MYB52(1)          <------ZmHOX2a(1) ---------->DOF2                 --------->AHL20(2)
-->MYB46(1)     <---------MYB46(3) --------->GLK1(2) <---------ICU4    --------->ARR11(3)        <--
----MYB59  <---------WOX13(1)----------->RAV1(1) --------->AHL20(2)    <---------ARR11(3)   --------
 
aactgctacttctgatggattgttgaaggagacaacaaaatcttgaaaagaattaaaaattagaaaatgtgaaagattttattgatatcttaaaagaaag  16532900
                                                                                          --------->DOF5.7(1)
                                                                                      ----------->HVH21
                                                                                     ------->MYC2
                                                                                     <-------MYC3
                                                                                     <-------MYC2
                                                                 <---------YAB5      ------->MYC3
                                                               --------->YAB1       --------->O2
                                                    <---------AHL20(2)              --------->ANAC58
                        <---------MYB46(3)          --------->AHL25(1)              <---------ANAC55(2)
                <----------DOF2                     --------->AHL12(3)              ===============bZIP_DOF
          --------->ANAC55(2)                       <---------AHL12(3)              <---------O2
          --------->ANAC58                          <---------AHL25(1)              <---------TGA1a
          --------->ANAC58                         --------->AHL25(3)               --------->ANAC55(2)
          <---------ANAC55(2)                      <---------AHL25(2)               --------->TGA1a
       --------->ARR14(2)    <---------ANAC46      --------->AHL25(2)               --------->ANAC58
       <---------ARR14(2)<-------GAMYB            --------->CCA1(2)                 --------->ANAC46
       <---------ARR11(2)<---------ANAC58        --------->ARR11(3)                 ===============bZIP_DOF
--------->YAB1 <---------DOF5.7(1)               <---------RVE1(2)<---------ICU4  <---------ALFIN1--
-------GLK1(1)<---------DOF5.7(1) --------->AHL12(2)--------->AHL25(3)        <-----------HVH21  <--
-->DOF2--------->ARR11(2)<---------ANAC58        <---------ARR11(3)      <---------YAB1 ---------->DOF2
 
aaatcagaaggttacgcctctttctcttggttgtgttttttttttggtatgagatataatttgaattcatcatctcatcaatgtcacacgtgaaagaccc  16533000
                      ---------->DOF2                                  <---------AHL20(2)
                 --------->LBD16                             <---------AHL25(3)
                --------->ANAC46                             <---------AHL20(2)
                <---------HSFB2a(2)                         --------->AHL20(2)                  <---
          <---------ALFIN1---------->DOF2                   --------->AHL25(3)             ---------
--------->YAB1  --------->HSFB2a(2)     <---------AHL12(2) --------->AHL12(2)            --------->RVE1(2)
------->RVE1(2)<---------LBD16        *TSS                 --------->WOX13(2)      --------->YAB1
-------CCA1(2)------>ZmHOX2a(1)  ----------->GT1           <---------WOX13(2)----------->GT1   -----
 
atatcatactctccctcctccggaagaaagaaagaatggaaaaaaaaaactttgaatttcttatttaatagtatataatatggtaataagaaaatcaaat  16533100
                                                      <---------ANAC58
                                                      <---------ANAC46
                                                  <------MYB83
                                                  <------MYB46(1)
                                   --------->ANAC58   <---------ANAC58
                                   --------->ANAC58  <---------MYB46(3)
                                 ---------->DOF2 --------->MYB55(2)
                           <---------ANAC58      <---------DEAR3(1)
                           <---------ANAC58      <---------MYB46(3)
                       <------------CBF          --------->MYB111(1)                  --------->LBD16
                     <---------RVE1(2)           --------->MYB46(2)             --------->YAB5
                     --------->ARR11(3)          --------->MYB111(2)           <---------YAB5
                     <---------ARR14(3)          <---------AtMYB61        <---------ANAC58
  <----------DOF2    --------->ARR14(3)         <---------MYB55(1)        <---------ANAC46
------AHL25(3)       <---------ARR11(3)         <--------P     ----------->RAV1(2)    ------>ZmHOX2a(1)
>AHL20(2)            --------->ARR14(2)        <---------MYB52(1)------>ZmHOX2a(1)   <---------LBD16
---->AHL20(2)        <---------ARR14(2)   --------->GLK1(2)------->TEIL   <---------ANAC58
 
aaaaactttattttgttttctgaagatattgcttcagaaagccataatctggttggtgcttgaacctcctgcttcttgcttattgattcctggagtcaag  16533200
                  --------->ATHB12
                  <---------AHL25(3)
                  <---------ICU4
                  --------->ATHB51
                  -------->ATHB1
                 --------->AHL25(2)
                 --------->AHL20(1)
                 <---------AHL25(1)
                 <---------AHL20(2)
                 --------->ICU4
                 --------->AHL25(3)
                 --------->AHL12(1)
                 <---------YAB1
                 <---------AHL12(1)
                 <---------AHL25(2)                                          <------MYB83
                 <---------ATHB51                                            <------MYB46(1)
                <---------AHL12(2)                                          <---------AtMYB61
                --------->AHL20(3)                  <------ZmHOX2a(1)      <---------MYB52(1)
                --------->AHL12(2)                <---------TOE1(3)   -------->P    <---------MYB59
                <---------AHL25(2)  <---------AHL12(3)               ------->GAMYB  --------->AtMYB61
                <---------AHL20(3)  <---------AHL20(3)         --------->TOE2(3)--------->ETT(2)
                --------->AHL25(2)  <---------AHL25(1)         <----------DOF2  <---------ETT(2)
           ----------->GT1          <---------AHL20(2)     <---------CCA1(2)<---------MYB46(3)
      --------->DOF5.7(1)    ----------->GT1      <---------TOE2(3) --------->MYB46(3)
    ---------->DOF2  ----------->GT1--------->AHL20(2)  --------->GLK1(2)  <--------P
 
tctttggtaaagagaagaaaattattgtgaaaatgttatataaatgtatggttaaggagtttctatctttaacaaccagttggtcgacctaaacccctct  16533300
                                                                                    --------->ARR11(2)
                                                                                    --------->ARR14(2)
                                                                                    --------->RVE1(2)
                            --------->TOE2(3)                                       --------->ARR11(3)
                            --------->TOE1(3)                                       <---------ARR14(2)
                            --------->YAB1    <-----------GT1                       <---------ARR11(3)
                         ------>MYB83         --------->ZAT6                <---------AHL20(2)
                         ------>MYB46(1)    --------->RVE1(2)              <---------AHL25(1)
                  ------>ZmHOX2a(1)       ------>ZmHOX2a(1)             --------->YAB5 --------->ANAC46
                 --------->TOE2(3)       --------->TOE2(3)              --------->ATHB12------>ZmHOX2a(1)
                --------->YAB1           --------->TOE1(3)      <-----------GT1<---------ATHB12   --
              --------->ARR14(2)       <---------ATHB12       <---------WOX13(2)   --------->KAN1 <-
     <----------DOF2   --------->TOE2(3)--------->YAB5        --------->WOX13(2)--------->YAB5 -----
    <---------DOF5.7(1)<---------MYB59--------->ARR14(2)     <---------ICU4--------->AHL20(2) <-----
 
ctcttcatctttctcccaatcctaaacctaatcttaatcccaatccttatcactctctgtctcttaattacacattgattaaatcaatatcctccatata  16533400
                                                                                           ---------
                                                                                         --------->AHL12(3)
                                                                                         <---------AHL20(2)
                                                                                         --------->AHL20(2)
                                                                                         <---------AHL25(3)
                                                                                         <---------AHL12(3)
                                                                                         --------->AHL25(1)
                                                                                         --------->AHL25(3)
                                                                                         <---------AHL25(1)
                                                                                      <---------WOX13(2)
                                                                                      --------->WOX13(2)
                                                                                   --------->AHL25(3)
                                                                                   <---------AHL25(1)
                                                                                   --------->AHL20(2)
                                                                                   <---------AHL20(2)
                                                                                   --------->AHL12(3)
                                                                                   --------->AHL25(1)
                              <----------ID1                                    --------->WOX13(2)
                             ----------->GT1                                    <---------WOX13(2)
          <-----------GT1  ---------->DOF2   --------->KAN1                   <---------AHL20(2)
------->YAB1           <---------------------WRI1                         <---------At4g35610
----------GT1    --------->WOX13(2)    --------->RVE1(2)            --------->DAG2 <---------AHL12(3)
---->YAB1 <---------AHL20(2)--------->DAG2---------->DOF2          ---------->DOF2 <---------AHL25(3)
----AHL20(2) <----------DOF2<---------------AtSPL8      <---------GLK1(2) --------->At4g35610 <-----
 
atcacatttctattttctttacttaagttgaaaagtacaaagaatcaaagatgctactagcttcttgacataaagtcatcttaaatttaaatttaaattc  16533500
<- Previous    Next ->

AGI:  At4g34610.1   
Description:  BLH6 (BELL1-LIKE HOMEODOMAIN 5); DNA binding / transcription factor. Identical to BEL1-like homeodomain protein 6 (BLH6) [Arabidopsis Thaliana] (GB:O65685); similar to BLH7 (BELL1-LIKE HOMEODOMAIN 7), DNA binding / transcription factor [Arabidopsis thaliana] (TAIR:AT2G16400.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO47209.1); contains InterPro domain POX (InterPro:IPR006563); contains InterPro domain Homeodomain-related; (InterPro:IPR012287); contains InterPro domain Homeodomain-like (InterPro:IPR009057); contains InterPro domain Homeobox; (InterPro:IPR001356)
Range:  from: 16530351    to: 16533039    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version