AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
              --------->YAB5
          --------->DEAR3(1)
         <-----------RAV1(2)
         --------->DEAR3(2)
---------RVE1(1)
---------CCA1(1)                                                                                ----
--------ARR11(3)        --------->ZAT18      --------->MYB52(2)            --------->ZAT14   ------>MYB83
------->ARR11(3)      --------->ANAC46 ----------->RAV1(1)                 <---------ZAT14   ------>MYB46(1)
--------RVE1(2)  --------->YAB5     ------>ZmHOX2a(1)           ------>ZmHOX2a(1)       <-----------GT1
 
agatattttggcacagacgatgactaggccactgtgttcctgcagcattagttgtcccatccatgtcctgcatagcagtttactgatgcattcaccatcc  13388000
                                                               <-----------GT1
                                                   <<<<<<<<<MYB2
                                                 <------MYB83 <-----------GT1
                                                 <------MYB46(1)
                                                 <---------MYB46(3)
                                    <---------DOF5.7(1)      --------->AHL20(2)
                         ---------->DOF2     <-----------RAV1(1)
                       <---------YAB1<----------DOF2  <-----------GT1       --------->ALFIN1
-->ZmHOX2a(1)         --------->RVE1(2)    <----------DOF2   <---------AHL20(2)<---------ANAC46
 
tattctctacaacggctacacaaactatcaaaggaatcacctttaactttgttggttttcccatttaaaccccctcaaggtgttgggaacagttttgttt  13388100
                                                           <---------AHL12(3)
                                                           <---------AHL25(1)
                                                           --------->AHL12(3)
                                                           <---------AHL20(3)
                                                           <---------AHL12(1)
                                          --------->ARR14(2)
                                          <---------RVE1(2)--------->AHL25(1)
                                          --------->ARR11(2) --------->WOX13(2)
                                          --------->GATA12 --------->AHL12(1)
                               <---------ANAC55(2)         <---------YAB1
                               <---------LBD16             --------->AHL20(2)
                               --------->LBD16             --------->AHL20(3)
                            <------ZmHOX2a(2)              <---------AHL20(2)
                           <---------ARR11(2)             --------->AHL25(3)
                    <--------P<---------LBD16           --------->RVE1(2)
             --------->ALFIN1 --------->TOE1(2)  <---------SPL7(1)
           --------->O2    --------->ARR11(2)    --------->ZAT14 <---------YAB1
           <---------O2  ------>ZmHOX2a(2)<---------ARR14(2)--------->YAB5
           --------->TGA1a --------->GATA12   <---------ANAC46 <-----------GT1
           <---------TGA1a <---------GATA12--------->ARR14(1)<---------WOX13(2)    --------->AHL12(2)
           ==================MYC_MYB      <---------ARR11(2)<---------ICU4       <---------YAB1
 <---------YAB1 <---------ANAC46--------->LBD16--------------->AtSPL8    <---------GLK1(1)  --------
 
acttataaatgcccaagtgaggggttgatcgatcccgggacttgggattcggtgtaccatatataattacccttggaactcttgataattcatctacaac  13388200
                --------->CCA1(1)
                --------->KAN1
                --------->RVE1(1)
              <---------AHL20(3)
              --------->AHL12(3)
              --------->AHL20(3)
            --------->AHL12(3)
            <---------AHL20(2)
            <---------AHL12(3)
            --------->AHL20(2)
            --------->AHL20(3)
            <---------AHL25(1)                                                <---------PCF2
            --------->AHL25(1)                                               ----------->TCP11(1) <-
            <---------AHL20(3)                                             --------->ALFIN1 <-------
  --------->ZAT18 <---------YAB1                                          ------->MYC3      --------
  <---------ZAT18--------->ARR11(3)                                       <-------MYC3      --------
 <---------ANAC58<---------ARR11(3)            <---------KAN1          <---------KAN1      ---------
 <---------ANAC58--------->RVE1(2)           --------->YAB1       --------->ANAC58  <---------MYB46(3)
--------------->AtSPL8            --------->KAN1                  --------->ANAC58  --------->ATHB12
->REM1(1)--------->RVE1(2)       <---------RVE1(2)              ---------->DOF2    <---------ATHB12<
 
tcttgtgtaccatatataaatatccttggaacccttgatactccataagcataatacatttggcttcgaaaggaacatgtgggccaatggttgcaccacc  13388300
                                                                                               <----
                                                                                               -----
                                                                                               -----
                                                                                               <----
                                                                                               -----
                                                                                               <----
                                                                                               <----
                                                                                               <----
                                                                                               <----
                                                                                               -----
                                                                                              ------
                                                                                              <-----
                                                                                              ------
                                                                                              <-----
                                                                                              ------
                                                                                              <-----
                                                                                              ------
                                                                                              <-----
                                                                                              ------
                                                                                ---------->DOF2-----
                                                                         <---------ICU4       <-----
                                                                         --------->YAB1       ------
                                                                        <---------ATHB12    <-------
      --------->At4g35610                             <------MYB83      --------->ICU4      --------
      <---------At4g35610                             <------MYB46(1)   <---------ATHB51    *TSS<---
   <---------YAB5                                --------->ALFIN1      <---------WOX13(2)   --------
----------RAV1(1)                              <---------O2            --------->WOX13(2)   --------
--ALFIN1                   <---------ZAT2      ============================================bZIP_DOF
->AtMYB61                 <---------ARR14(2)   <---------TGA1a      ------------>CBF   ----------->GT1
->DEAR3(1)                --------->ARR14(2)   --------->O2     --------->MYB46(3)   ---------->DOF2
>MYB46(3)             <-------TEIL             ============================================bZIP_DOF
-------GAMYB      <---------TOE2(3)            --------->TGA1a ------->TEIL<---------YAB1   <-------
 
tctgttgtcatctcatgaattcaggttcggacctggtctctctctctcccaagtgggaggtatatgaacggcccaattatgacaaaaggaaagaaaatta  13388400
    <----------DOF2
-----AHL20(3)
---->AHL20(3)
---->AHL25(1)
-----AHL20(1)
---->AHL20(1)
-----AHL20(2)
-----AHL25(3)
-----AHL25(2)
-----AHL25(1)
---->AHL25(2)
--->AHL25(1)
----AHL25(1)                    <---------MYB46(3)
--->AHL25(3)                 <------MYB46(1)
----AHL25(3)                 <------MYB83
--->YAB1                     <---------ANAC46--------->MYB52(2)
----AHL12(1)                --------->MYB111(1)
--->AHL12(1)                --------->MYB111(2)
----AHL12(3)                <---------MYB46(3)
--->AHL20(2)                <---------AtMYB61--------->MYB55(2)
---->AHL25(3)               --------->MYB46(2)<---------ANAC46
----AHL20(2)       --------->RVE1(2)         <------MYB83
--->AHL12(3)       <---------ARR11(3)        <------MYB46(1)
--AHL20(3)        <---------CCA1(2)          <---------MYB46(3)                                    -
->AHL20(3)       --------->AHL20(1)         <---------AtMYB61                                      <
------YAB1       <---------AHL20(1)      <-----------RAV1(1)      <---------YAB1            --------
->AHL25(2)       <---------AHL25(2)  <---------ANAC46--------->ALFIN1      --------->ARR14(2)  <----
->AHL12(2)       <---------ARR11(3) <-----------------------TaNAC69(2)     <---------ARR14(2)------>ZmHOX2a(1)
--AHL12(2)--------->RVE1(2) --------->MYB55(2)<-------GAMYB   ----------->GT1     <---------ZAT2   -
 
tatttggcttcaatgtccaatatatctaagtttggtggtgacttatgttggttgaagtgtgagagaggtattatagaaaatactctgctcgttctcctcc  13388500
                                                                   <---------LBD16
                                                             <---------ICU4
                                                             --------->YAB1
                                                             -------->ATHB1
--------->RVE1(2)                                            --------->YAB5
--------->ARR14(2)                                           --------->KAN1                   <-----
<---------ARR11(2)                                          <---------ATHB12                  ------
<---------ARR14(2)         <---------ARR11(2)               --------->ICU4                    ------
--------->ARR11(2)         <---------ARR14(2)          --------->ANAC58                       <-----
-------->GLK1(1)           --------->ARR11(2)          --------->ANAC58             >>>>>>>>>MYB1
---------CCA1(2)           --------->ARR14(2)          --------->ANAC46       <----------DOF2 ------
->ANAC46 <----------DOF2  --------->GLK1(1)      <---------ZAT6    ------>ZmHOX2a(1)>>>>>>>>>MYB2
-----ALFIN1     <---------RVE1(2)           <------MYB46(1) <---------YAB5   <---------DOF5.7(1)
-------->KAN1   --------->ARR11(3)          <------MYB83  --------->WOX13(1)<---------DOF5.7(1)
 
acatatccaagactttggagataatgctggtatccttggctagcatttggtagtgtcgaagcaatcattcctcgggctctcctttctaactgcattccta  13388600
          ---------->DOF2
       --------->TOE1(3)
       --------->TOE2(3)
    <-----------GT1
 <---------ICU4                                                        --------->ATHB51
 <---------AHL12(2)                                                    --------->YAB5
--------->ICU4                                                         --------->YAB1
<---------AHL20(1)                                                     <---------ICU4
--------->AHL12(1)                                                     -------->ATHB1
<---------AHL12(1)                                                     <--------HAHB4
--------->AHL25(3)                                                    --------->ICU4
<---------AHL25(2)                                                    --------->AHL25(3)
--------->AHL25(2)                              <------ZmHOX2a(1)     <---------YAB5
--------->AHL20(3)                          <---------ZAT2            <---------AHL12(1)
<---------AHL20(3)                          --------->At4g35610       --------->AHL12(1)
--------->AHL20(1)                          --------->ZAT2            <---------YAB1
<---------ARR11(3)                          <---------At4g35610      <---------AHL12(2)           <-
--------->ARR11(3)                 ---------->ID1                    --------->AHL12(2)           <-
----HSFC1(1)                     --------->TOE2(1)          <---------ANAC46                      --
--->HSFB2a(2)         <---------ANAC58 <---------DOF5.7(1)  <---------ANAC58                  <-----
>ZmHOX2a(1)           <---------ANAC58------>ZmHOX2a(1)     <---------ANAC58          <----------DOF2
----HSFB2a(2)    <----------DOF2 --------->TOE1(1)     --------->At4g35610      --------->ARR14(2)--
--->HSFC1(1)--------->DOF5.7(1) ------>ZmHOX2a(1)      <---------At4g35610<-----------GT1     ------
 
gaaaatattaccctaaaggcctttgtcttggcatcctcgtcctcttcagcaggaactcatctgtcttggaagaattattaccatgtctgcttttgtcagc  13388700
            --------->ZAT18
            <-------TEIL
            <---------ZAT14
            --------->ZAT14
            <---------ZAT18
        <---------------AtSPL8
        --------------->AtSPL8
       <--------P
    <---------TOE2(3)
--------ARR11(2)
--------ARR14(2)                                                                          --------->At4g35610
------->ARR11(2)                           --------->HSFB2a(2)                       <---------At4g35610
----At4g35610  --------->ANAC46            <---------HSFB2a(2)                       --------->At4g35610
------->ARR14(2)            <---------DOF5.7(1)  <---------YAB5          <----------DOF2  <---------At4g35610
--->At4g35610  --------->ANAC55(1)  <---------ANAC46             <---------AHL20(2)<-----------RAV1(2)
 
aaatacgaaggtaagtacacttaatatgcactcttctcttcgtgttccagtaatcttcagttctccattttatgtgctttctgagttcagatgagctgat  13388800
                                             <---------At4g35610
                                             --------->At4g35610
                                           <-----------RAV1(2)
                                         <---------RAP2.3(1)
                            --------->DOF5.7(1)     <---------ZAT14
                           --------->DOF5.7(1)      --------->ZAT14                  <---------KAN1
                        <------NtERF2   <---------RAP2.3(3)                          <---------YAB5
                        ----------->HVH21------>NtERF2                            <------NtERF2
                       --------->HSFB2a(2)<---------At4g35610                    --------->LBD16
                       ------>NtERF2    <---------RAP2.6(2)                     --------->LBD16
                       <---------HSFB2a(2)<------NtERF2                   <---------GLK1(2)
                       --------->LBD16  --------->ATERF1(2)               --------->ARR14(2)
                      --------->LBD16   <---------ATERF1(2)               <---------ARR14(2)
                      <---------ANAC46  <---------DEAR3(1)                --------->ARR11(2)
                     <---------LBD16    <---------RAP2.3(2)              --------->YAB5          <--
          <-------TEIL<---------LBD16  --------->RAP2.6(3)           --------->ARR11(2)          ---
 <---------RAP2.6(2)------->GAMYB<----------DOF2    --------->ZAT18  <---------ARR11(2)   --------->YAB5
--------->RAP2.6(3)--------->DEAR3(1)  <---------LBD16        --------->ATHB12 <---------LBD16   ---
 
caagacggccaagtacattgcaacgccgggaaggggcattttggcggcagatgagagcacagaaaccattgggaaacgattcgccggaatcaatgttgag  13388900
<- Previous    Next ->

AGI:  At4g26510.1   
Description:  uracil phosphoribosyltransferase / UMP pyrophosphorylase (UPT1). similar to uracil phosphoribosyltransferase, putative / UMP pyrophosphorylase, putative / UPRTase, putative [Arabidopsis thaliana] (TAIR:AT1G55810.2); similar to uracil phosphoribosyltransferase, putative / UMP pyrophosphorylase, putative / UPRTase, putative [Arabidopsis thaliana] (TAIR:AT1G55810.3); similar to uracil phosphoribosyltransferase, putative / UMP pyrophosphorylase, putative / UPRTase, putative [Arabidopsis thaliana] (TAIR:AT1G55810.1); similar to hypothetical protein OsI_034512 [Oryza sativa (indica cultivar-group)] (GB:EAY80553.1); similar to hypothetical protein O
Range:  from: 13384070    to: 13388297    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
AGI:  At4g26520.1   
Description:  fructose-bisphosphate aldolase, cytoplasmic. Identical to Fructose-bisphosphate aldolase, cytoplasmic isozyme [Arabidopsis Thaliana] (GB:P22197;GB:O65582;GB:Q53YH0); similar to fructose-bisphosphate aldolase, putative [Arabidopsis thaliana] (TAIR:AT4G26530.2); similar to fructose-bisphosphate aldolase, putative [Arabidopsis thaliana] (TAIR:AT4G26530.1); similar to fructose-bisphosphate aldolase [Pandanus amaryllifolius] (GB:AAR88661.1); contains InterPro domain Aldolase-type TIM barrel; (InterPro:IPR013785); contains InterPro domain Fructose-bisphosphate aldolase, class-I; (InterPro:IPR000741)
Range:  from: 13388393    to: 13390381    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version