AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
           --------->LBD16
           --------->At5g28300
          <---------ANAC58                --------->GLK1(1)                                    -----
      <---------MYB52(1)              <------NtERF2                                            -----
      --------->ATERF1(1)           <---------ANAC46                                           -----
     <---------At4g35610            --------->ALFIN1                                           <----
     <-------GAMYB                <---------MYB46(3)                                        --------
<---------WOX13(1)               <-----------RAV1(1)                                        --------
---------ANAC58          <---------MYB52(1)                                                 <-------
---------ANAC58         <-------GAMYB<---------MYB46(3)                     ----------->GT1 <-------
------->ATHB12         <-----------RAV1(1)<---------GLK1(1)               --------->ZAT14   <-------
-------YAB1<---------RAP2.6(3)   <---------AtMYB61                 >>>>>>>>>TBF1       <---------YAB1
--->GATA12<---------ANAC58     <---------ANAC46      <---------ANAC58     <---------ZAT14   --------
----GATA12--------->ANAC55(2)  <-----------RAV1(1)   <---------ANAC58 <---------ARR14(2)--------->YAB5
 
ttgattgccgttgccgtaacatttgactgttgttttgtggtggggaattctagggttcttgtttgatgaagaagaactgaagtgaaaatgaccattaaaa  13362200
                                                                                                <---
                                                                                               <----
                                                                                               -----
                                                                                               <----
                                                                                               -----
                                                                                               -----
                                                                                               <----
                                                                                               -----
                                                                                               <----
                                                                                               -----
                                                                                              <-----
                                                                                           <--------
                                                                                           ---------
                                                                                           ---------
         --------->YAB5                                                               ------>ZmHOX2a(2)
         --------->ATHB12                                                           --------->AGP1<-
        <---------YAB1                              <---------KAN1                  <---------AGP1--
        --------->ICU4                              <---------YAB5                  --------->GATA12
---->GATA12                                        <---------KAN4(2)                <---------GATA12
---->RVE1(2)                                 --------->ARR11(2)                     <---------ARR14(2)
---->ARR11(3)                                <---------ARR11(2)                     --------->ARR11(3)
-----ARR11(3)                              ------->GAMYB                            --------->ARR14(2)
->AHL25(1)                                --------->ANAC58        <---------HSFB2a(2)<------ZmHOX2a(2)
->AHL20(2)                                --------->ANAC58     --------->GLK1(2)    <---------RVE1(2)
--AHL20(2)                              --------->MYB52(1)    <---------GLK1(2)     <---------ARR11(3)
--AHL25(1)            --------->KAN1   <---------WRKY38(1)   --------->KAN1        <---------CCA1(2)
--AHL20(3)           <-------TEIL      <---------WRKY12 ------>ZmHOX2a(2)         ----------->ARR10
->AHL20(3)          <---------MYB52(1) <---------KAN1--------->YAB1           ----------->GT1 <-----
 
tctcccatgagatgattgtgtccgttcattcttcgaaatcggacaacggaatcgaatgatcgtcatattctgtaagagagaaggttagatcttcaccgaa  13362300
         --------->AGP1
         --------->ARR14(2)
         <---------ARR14(2)
         <---------ARR11(2)
         --------->GATA12
         --------->ARR11(2)
         --------->ARR11(3)
         --------->RVE1(2)
------KAN1<------ZmHOX2a(2)
-----GATA12
---->GLK1(2)
-----ARR11(1)
---->ARR14(2)
---->GATA12
-----ARR11(2)
-->TEIL  <---------ARR11(3)
-----ARR14(2)
---->ARR11(2)
----GLK1(2)<-------TEIL                             <------MYB83                                  --
---------AGL1                                       <------MYB46(1)                               --
-------->AGL1                                      <---------AtMYB61                            <---
>ANAC46  <---------GATA12    <-----------GT1     <------------CBF                             <-----
--------HSFB2a(2)         <---------RVE1(2)     --------->ATHB12                      <---------ANAC46
------->HSFB2a(2)   --------->KAN1            --------->ANAC58                       <---------MYB52(1)
----ARR14(1)     <---------MYB52(1)           --------->ANAC58                  --------->GLK1(2) --
 
tctggaactcgagatccatcgttttgttcgattttctattctttcgcacaaggattggtctgagaagaacaagttcaagttagaagctgttgtgttctgt  13362400
         --------->WOX13(2)
         <---------WOX13(2)
----------->HVH21--------->At4g35610        <---------DOF5.7(1)
------->LBD16    --------->ZAT2            <---------DAG2
------->At4g35610<---------At4g35610       <----------DOF2
------LBD16   --------->At4g35610       <-----------GT1
------HVH21   <---------ZAT2    ---------->DOF2                                             <-------
--------->GT1 <---------At4g35610    ----------->GT1                                        --------
 
ccggtgaaacttatttgagctgctgcaaaaacttcaaaagttgttactttttctgaaataacttaagcttcttggtattttgagactaaatggtttcact  13362500
                                                                                                   -
                                                                                                  --
                                                                                                 <--
                                                                                                 <--
                                                                                                 <--
                                                                                                 ---
                                                                                                 ---
                                                                           ------->GAMYB         <--
                  --------->YAB1                                          --------->ANAC58       ---
               <---------GLK1(1)                                          --------->ANAC46       ---
               --------->GLK1(1)                                     --------->ANAC58            <--
           ------>ZmHOX2a(1)                                  <---------ANAC58                   <--
           <---------HSFB2a(2)                                <---------ANAC58 --------->ICU4    ---
           --------->HSFB2a(2)                               <-------TEIL --------->ANAC58     -----
           --------->LBD16                               --------->DOF5.7(1)   <-----------RAV1(1)<-
      <---------GLK1(1)                                 <---------------------WRI1       <----------
----GT1   <---------LBD16 <---------YAB1               ---------->DOF2 <---------WRKY38(1)   <------
->ZAT6--------->GLK1(1) ----------->GT1            <----------ID1    --------->ANAC58    <----------
 
actcttgtgaattcctggaaatcagaactgttattagttttttttgtatatttagggacaaagatgcatgctaggcaacgcaatgttgggaatgggtaca  13362600
----->ZmHOX2a(2)
------->CCA1(2)
-------AGP1
-------ARR11(3)
-------ARR11(2)
------>AGP1
------>ARR11(3)
-------RVE1(2)
------>ARR11(2)                                --------->ZAT18
------>ARR14(2)                         ----------->RAV1(2)                                     <---
-------ARR14(2)                         <---------LBD16                                 <---------ALFIN1
-------GATA12                    <---------GLK1(2)                                     ------>MYB46(1)
------>GATA12                 <---------HSFC1(1)                                       -------->P<--
------>ARR10                  --------->HSFB2a(2)                                      ------>MYB83
-----ZmHOX2a(2)               >>>>>>>ZML2 ------>ZmHOX2a(1)                           ----------->RAV1(1)
-----AtSPL3                   <---------HSFB2a(2)                          --------->ARR11(2)   <---
-TEIL                         --------->HSFC1(1)           <------ZmHOX2a(1)         --------->AtMYB61
-----AtSPL8         <---------KAN1 <---------KAN1  ------>ZmHOX2a(1)       <---------ARR11(2)   <---
 
gatctggttctattgggatgggtatgtctggttctagaatttctcctgagcgtcctatgagaggacatgggttctatggttctgaacaccaacaccgtgg  13362700
                                                              --------->At4g35610
                                                              <---------At4g35610
                                                           ------>NtERF2
                                                           --------->LBD16
                                                          --------->ANAC46
         --------->CCA1(2)                                <---------ALFIN1
        <---------RVE1(2)                                 --------->DEAR3(1)
        <---------ARR11(2)                               --------->ATERF1(1)
        <---------ARR14(2)                              <---------ATERF1(1)
        --------->ARR14(2)                              ------>NtERF2               <---------ANAC46
        --------->ARR11(2) --------->ANAC58       <---------ZAT2                --------->ABI4(2)  <
    --------->LBD16        --------->ANAC58       --------->At4g35610           <---------ZAT14   <-
   ------->GAMYB --------->ALFIN1                 <---------At4g35610           --------->ZAT14   <-
 <---------At5g28300  --------->DOF5.7(1)         --------->ZAT2 ------>NtERF2 --------->ALFIN1   <-
------ANAC46    ------->PIF5         --------->YAB1   --------->ATERF1(1)<---------ALFIN1        <--
--------DOF2    <-------PIF5         --------->YAB5  ------>NtERF2  ------>NtERF2  <---------At4g35610
------ANAC58   <---------ANAC46     <---------ATHB12 <---------ATERF1(1)--------->MYB46(3)     -----
------ANAC58  ------->TEIL--------->SPL7(1)       ----------->RAV1(2)  ------>ZmHOX2a(1)---------->DOF2
 
ctttaaccgtggatatggacgtggaaggggacgctctaaatcataccacaatcagctgcctccgcctctgcctcctccaccggtgcagcgtagaagcagt  13362800
          <---------AtLEC2
    <---------bZIP60(2)
    <---------ANAC58
    <---------ANAC46
    <---------ANAC58
   ----------->STF1
 ----------->HVH21
 ----------->TGA1
--------->ATERF1(1)
--------->At5g28300
<------NtERF2               --------->ANAC58
---------MYB46(3)           --------->ANAC58
--------ANAC46      <------MYB46(1)  --------->ZAT14                           <---------HSFB2a(2)
--------DEAR3(1)    <------MYB83  ------->GAMYB                                --------->HSFB2a(2)
--------DREB2C(2) =========================RAV                             <----------DOF2         <
-------ABI4(1)    <-----------RAV1(2)<---------ZAT14                      <---------ANAC58     -----
---->ALFIN1      <------NtERF2 ----------->RAV1(1)                        <---------ANAC58     -----
 
ggcggtgacgttttcatggaggcaggtcgtctagcaacagagtacttggtttctcaaggtgttctaccacaaactgtgctttccagtaaatggcagaatg  13362900
                                                                                     --------->DOF5.7(1)
                                                                         --------->ZAT2
                                                                         <---------ZAT2
             <---------ZAT2                                              --------->At4g35610
        --------->ANAC58                                           --------->At4g35610   -----------
        --------->ANAC58                                           <---------At4g35610--------->DOF5.7(1)
      <------ZmHOX2a(1)                                            <---------ZAT2   --------->DOF5.7(1)
    <---------TOE2(3)             --------->LBD16                  --------->ZAT2  ---------->DOF2
---------WOX13(2)                <---------HSFB2a(2)         --------->YAB5 --------->At4g35610
---->YAB1    --------->At4g35610 --------->HSFB2a(2)       ------->TEIL  <---------At4g35610
------>GT1   --------->ZAT2  --------->GLK1(1)          <---------KAN1 <-----------RAV1(2)       ---
 
gtaattttaggaagcaagctggagagtttcagagttccaggtctcaagaagaagcccgaatggatgtttcagctccagctgcagagaaaaggaggtatat  13363000
                                                                                <---------RVE1(2)
                                                                                <---------ARR11(3)
                                                                                <---------AGP1
                                                                                --------->ARR14(2)
                                                                                <---------ARR14(2)
                                                         --------->YAB5         --------->ARR11(2)
                                                        <---------YAB1          <---------ARR11(2)
                       <------ZmHOX2a(1)             <---------MYB52(1)         <---------GATA12
                       ==============================HOX2a_HOX2a                --------->ARR14(3)
                       =============================HOX2a_HOX2a                 --------->GATA12
                     --------->LBD16          ------>ZmHOX2a(2)                 <-----------ARR10
                    <---------LBD16         --------->ARR11(3)                  <---------ARR11(1)
                   ------>ZmHOX2a(2)        --------->ARR14(2)                  <---------ARR14(3)
                   =============================HOX2a_HOX2a                    <---------ARR14(1)
                  <------ZmHOX2a(2)         <---------ARR14(2)              <---------At4g35610
                  ==============================HOX2a_HOX2a               ===============HOX2a_HOX2a
                 <---------ARR11(2)         --------->ARR11(2)            ==============HOX2a_HOX2a
                 <---------GATA12           <---------ARR11(2)            <------ZmHOX2a(1)
                 --------->ARR11(2)         <---------ARR11(3)   <---------KAN1<---------CCA1(2)
                 --------->GATA12           --------->GATA12    --------->GATA12--------->ARR11(3)
                 --------->ARR14(2)         <---------GATA12    --------->ARR14(2)    <-----------HVH21
            ----------->RAV1(2)            --------->GLK1(1)    <---------RVE1(2)<------ZmHOX2a(2)
            <---------At4g35610            <---------GLK1(1)    <---------GATA12--------->GLK1(2)
            --------->ZAT2   <---------ANAC58 ===================================HOX2a_HOX2a
            <---------ZAT2   <---------ANAC46<------ZmHOX2a(2)  <---------ARR14(2)------>ZmHOX2a(2)
            --------->At4g35610  ---------->DOF2<---------ALFIN1<---------GLK1(2)<---------KAN1
>GT1      <-----------RAV1(2)<---------ANAC58====================================HOX2a_HOX2a
------>ATHB12    <---------ARR14(2)      <------ZmHOX2a(1)  <---------LBD16 --------->At4g35610    -
 
tgatggctatagctcagctggatccaggaatagcttgaaaggaaggagatcccaccgttatgactcggattttgggaggagcggatcttggtcagagaga  13363100
<- Previous    Next ->

AGI:  At4g26450.1   
Description:  WIP1 (WPP-DOMAIN INTERACTING PROTEIN 1); protein heterodimerization/ protein homodimerization. similar to WIP2 (WPP-DOMAIN INTERACTING PROTEIN 2), protein heterodimerization/ protein homodimerization [Arabidopsis thaliana] (TAIR:AT5G56210.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN80099.1)
Range:  from: 13362564    to: 13368686    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version