AthaMap TU-Logo
Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
          <---------ANAC58                --------->GLK1(1)                                    -----
      <---------MYB52(1)              <------NtERF2                                            -----
      --------->ATERF1(1)           --------->ALFIN1                                           <----
     <---------At4g35610            <---------ANAC46                                           -----
     <-------GAMYB                <---------MYB46(3)                                        <-------
<---------WOX13(1)               <-----------RAV1(1)                                        <-------
---------ANAC58          <---------MYB52(1)                                                 --------
---------ANAC58         <-------GAMYB<---------MYB46(3)                     ----------->GT1 --------
------->ATHB12         <-----------RAV1(1)<---------GLK1(1)               --------->ZAT14   --------
-------YAB1<---------RAP2.6(3)   <---------AtMYB61                 >>>>>>>>>TBF1       <---------YAB1
--->GATA12--------->ANAC55(2)  <-----------RAV1(1)   <---------ANAC58     <---------ZAT14   <-------
----GATA12<---------ANAC58     <---------ANAC46      <---------ANAC58 <---------ARR14(2)--------->YAB5
ttgattgccgttgccgtaacatttgactgttgttttgtggtggggaattctagggttcttgtttgatgaagaagaactgaagtgaaaatgaccattaaaa  13362200
         --------->YAB5                                                               ------>ZmHOX2a(2)
         --------->ATHB12                                                           --------->ARR14(2)
        <---------YAB1                              <---------YAB5                  --------->ARR11(3)
        --------->ICU4                              <---------KAN1                  <---------ARR14(2)
---->RVE1(2)                                       <---------KAN4(2)                --------->AGP1<-
---->ARR11(3)                                --------->ARR11(2)                     --------->GATA12
-----ARR11(3)                                <---------ARR11(2)                     <---------AGP1--
---->GATA12                                ------->GAMYB                            <---------RVE1(2)
--AHL20(2)                                --------->ANAC58        <---------HSFB2a(2)<------ZmHOX2a(2)
--AHL25(1)                                --------->ANAC58     --------->GLK1(2)    <---------GATA12
->AHL25(1)                              --------->MYB52(1)    <---------GLK1(2)     <---------ARR11(3)
->AHL20(3)            --------->KAN1   <---------WRKY12 ------>ZmHOX2a(2)          <---------CCA1(2)
->AHL20(2)           <-------TEIL      <---------WRKY38(1)   --------->KAN1       ----------->ARR10
--AHL20(3)          <---------MYB52(1) <---------KAN1--------->YAB1           ----------->GT1 <-----
tctcccatgagatgattgtgtccgttcattcttcgaaatcggacaacggaatcgaatgatcgtcatattctgtaagagagaaggttagatcttcaccgaa  13362300
-->TEIL  --------->GATA12
----GLK1(2)<-------TEIL                             <------MYB83                                  --
-------->AGL1                                       <------MYB46(1)                               --
>ANAC46  --------->AGP1                            <---------AtMYB61                            <---
---------AGL1                <-----------GT1     <------------CBF                             <-----
--------HSFB2a(2)         <---------RVE1(2)     --------->ATHB12                      <---------ANAC46
------->HSFB2a(2)   --------->KAN1            --------->ANAC58                       <---------MYB52(1)
----ARR14(1)     <---------MYB52(1)           --------->ANAC58                  --------->GLK1(2) --
tctggaactcgagatccatcgttttgttcgattttctattctttcgcacaaggattggtctgagaagaacaagttcaagttagaagctgttgtgttctgt  13362400
----------->HVH21--------->ZAT2             <---------DOF5.7(1)
--------->GT1    --------->At4g35610       <---------DAG2
------->LBD16 <---------At4g35610          <----------DOF2
------LBD16   --------->At4g35610       <-----------GT1
------HVH21   <---------ZAT2    ---------->DOF2                                             --------
------->At4g35610<---------At4g35610 ----------->GT1                                        <-------
ccggtgaaacttatttgagctgctgcaaaaacttcaaaagttgttactttttctgaaataacttaagcttcttggtattttgagactaaatggtttcact  13362500
                                                                           ------->GAMYB         ---
                  --------->YAB1                                          --------->ANAC46       <--
               --------->GLK1(1)                                          --------->ANAC58       <--
               <---------GLK1(1)                                     --------->ANAC58            <--
           ------>ZmHOX2a(1)                                  <---------ANAC58                   ---
           <---------HSFB2a(2)                                <---------ANAC58 --------->ICU4    ---
           --------->HSFB2a(2)                               <-------TEIL --------->ANAC58     -----
           --------->LBD16                               --------->DOF5.7(1)   <-----------RAV1(1)--
      <---------GLK1(1)                                 <---------------------WRI1       <----------
->ZAT6--------->GLK1(1) ----------->GT1                ---------->DOF2 <---------WRKY38(1)   <------
----GT1   <---------LBD16 <---------YAB1           <----------ID1    --------->ANAC58    <----------
actcttgtgaattcctggaaatcagaactgttattagttttttttgtatatttagggacaaagatgcatgctaggcaacgcaatgttgggaatgggtaca  13362600
-------ARR14(2)                                --------->ZAT18
-------GATA12                           <---------LBD16                                         <---
-------RVE1(2)                          ----------->RAV1(2)                             <---------ALFIN1
------>GATA12                    <---------GLK1(2)                                     ------>MYB46(1)
------>ARR11(2)               --------->HSFB2a(2)                                      -------->P<--
------>ARR10                  <---------HSFB2a(2)                                      ------>MYB83
------->CCA1(2)               <---------HSFC1(1)                                      ----------->RAV1(1)
-----AtSPL3                   --------->HSFC1(1)                           <---------ARR11(2)   <---
-TEIL                         >>>>>>>ZML2 ------>ZmHOX2a(1)<------ZmHOX2a(1)         --------->AtMYB61
-----AtSPL8         <---------KAN1 <---------KAN1  ------>ZmHOX2a(1)       --------->ARR11(2)   <---
gatctggttctattgggatgggtatgtctggttctagaatttctcctgagcgtcctatgagaggacatgggttctatggttctgaacaccaacaccgtgg  13362700
         --------->CCA1(2)                                <---------ALFIN1
        <---------RVE1(2)                                 --------->DEAR3(1)
        <---------ARR11(2)                               --------->ATERF1(1)
        <---------ARR14(2)                              <---------ATERF1(1)
        --------->ARR14(2)                              ------>NtERF2               <---------ANAC46
        --------->ARR11(2) --------->ANAC58       <---------ZAT2                --------->ABI4(2)  <
    --------->LBD16        --------->ANAC58       --------->At4g35610           <---------ZAT14   <-
   ------->GAMYB --------->ALFIN1                 <---------At4g35610           --------->ZAT14   <-
 <---------At5g28300  --------->DOF5.7(1)         --------->ZAT2 ------>NtERF2 --------->ALFIN1   <-
------ANAC46    ------->PIF5         --------->YAB1   --------->ATERF1(1)<---------ALFIN1        <--
--------DOF2    <-------PIF5         --------->YAB5  ------>NtERF2  ------>NtERF2  <---------At4g35610
------ANAC58   <---------ANAC46     <---------ATHB12 <---------ATERF1(1)--------->MYB46(3)     -----
------ANAC58  ------->TEIL--------->SPL7(1)       ----------->RAV1(2)  ------>ZmHOX2a(1)---------->DOF2
ctttaaccgtggatatggacgtggaaggggacgctctaaatcataccacaatcagctgcctccgcctctgcctcctccaccggtgcagcgtagaagcagt  13362800
<------NtERF2               --------->ANAC58
---------MYB46(3)           --------->ANAC58
--------DEAR3(1)    <------MYB46(1)  --------->ZAT14                           <---------HSFB2a(2)
--------DREB2C(2)   <------MYB83  ------->GAMYB                                --------->HSFB2a(2)
--------ANAC46    =========================RAV                             <----------DOF2         <
-------ABI4(1)    <-----------RAV1(2)<---------ZAT14                      <---------ANAC58     -----
---->ALFIN1      <------NtERF2 ----------->RAV1(1)                        <---------ANAC58     -----
ggcggtgacgttttcatggaggcaggtcgtctagcaacagagtacttggtttctcaaggtgttctaccacaaactgtgctttccagtaaatggcagaatg  13362900
             <---------ZAT2                                              --------->At4g35610
        --------->ANAC58                                           --------->At4g35610   -----------
        --------->ANAC58                                           <---------At4g35610--------->DOF5.7(1)
      <------ZmHOX2a(1)                                            <---------ZAT2   --------->DOF5.7(1)
    <---------TOE2(3)             --------->LBD16                  --------->ZAT2  ---------->DOF2
---------WOX13(2)                <---------HSFB2a(2)         --------->YAB5 --------->At4g35610
---->YAB1    --------->At4g35610 --------->HSFB2a(2)       ------->TEIL  <---------At4g35610
------>GT1   --------->ZAT2  --------->GLK1(1)          <---------KAN1 <-----------RAV1(2)       ---
gtaattttaggaagcaagctggagagtttcagagttccaggtctcaagaagaagcccgaatggatgtttcagctccagctgcagagaaaaggaggtatat  13363000
                                                         --------->YAB5         --------->GLK1(2)
                                                        <---------YAB1          --------->ARR11(2)
                       =============================HOX2a_HOX2a                 --------->ARR11(3)
                       ==============================HOX2a_HOX2a                --------->GATA12
                       <------ZmHOX2a(1)             <---------MYB52(1)         <---------GATA12
                     --------->LBD16          ===================================HOX2a_HOX2a
                    <---------LBD16         --------->GATA12                    <---------RVE1(2)
                   ------>ZmHOX2a(2)        --------->ARR11(2)                  --------->ARR14(2)
                   =============================HOX2a_HOX2a                     --------->ARR14(3)
                  <------ZmHOX2a(2)         <---------GATA12                   <---------CCA1(2)
                  ==============================HOX2a_HOX2a                 --------->At4g35610
                 <---------ARR14(2)         <---------ARR14(2)            ==============HOX2a_HOX2a
                 --------->ARR11(2)         --------->ARR14(2)            ===============HOX2a_HOX2a
                 --------->ARR14(2)         <---------ARR11(2)            <------ZmHOX2a(1)
                 <---------ARR11(2)         --------->ARR11(3)   <---------KAN1<---------ARR14(1)
                 <---------GATA12           <---------ARR11(3)  <---------ARR14(2)    <-----------HVH21
            ----------->RAV1(2)            --------->GLK1(1)    <---------GLK1(2)<------ZmHOX2a(2)
            <---------At4g35610            <---------GLK1(1)    --------->ARR14(2)------>ZmHOX2a(2)
            --------->ZAT2   <---------ANAC58 ------>ZmHOX2a(2) <---------RVE1(2)<---------KAN1
            <---------ZAT2   <---------ANAC58<------ZmHOX2a(2)  --------->GATA12<---------AGP1
            --------->At4g35610          <------ZmHOX2a(1)  <---------LBD16 <---------At4g35610
>GT1      <-----------RAV1(2)<---------ANAC46====================================HOX2a_HOX2a
------>ATHB12    --------->GATA12---------->DOF2<---------ALFIN1<---------GATA12<---------ARR14(2) -
tgatggctatagctcagctggatccaggaatagcttgaaaggaaggagatcccaccgttatgactcggattttgggaggagcggatcttggtcagagaga  13363100
<- Previous    Next ->

AGI:  At4g26450.1   
Description:  WIP1 (WPP-DOMAIN INTERACTING PROTEIN 1); protein heterodimerization/ protein homodimerization. similar to WIP2 (WPP-DOMAIN INTERACTING PROTEIN 2), protein heterodimerization/ protein homodimerization [Arabidopsis thaliana] (TAIR:AT5G56210.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN80099.1)
Range:  from: 13362564    to: 13368686    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version