AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                  <---------AHL12(3)
                                  <---------AHL25(2)
                                  --------->AHL12(2)
                                  --------->AHL25(1)
                                  <---------AHL20(2)
                                 --------->AHL25(3)
                                 <---------AHL12(1)
                                 --------->AHL12(1)
                                <---------RVE1(1)
                               --------->ARR11(3)
                               <---------GLK1(2)
                        <---------AHL12(1)
                       <---------AHL12(2)
                       --------->AHL12(2)
                       --------->AHL20(3)
                       --------->AHL25(2)
                       <---------AHL20(3)               --------->AHL20(2)
                       <---------AHL25(2)               --------->AHL12(3)
                      --------->AHL12(1)                <---------AHL20(2)             --------->TOE2(3)
              <XXXXXXXXXXXXXXXXXXXXMIR781               --------->AHL12(2)           --------->RVE1(2)
             <---------ZAT6    --------->GATA12         <---------AHL25(1)           --------->GLK1(2)
       --------->RVE1(2)--------->AHL12(1)              --------->AHL25(1)           --------->ARR11(3)
       --------->ARR11(3)      <---------RVE1(2)        <---------AHL12(3)--------->KAN1
----------->GT1       <---------AHL12(1)       --------->KAN1         <----------DOF2<---------ARR11(3)
 
gagttgaaaatatcaagtgttcagaaaattttcagattttttttttgggtttattcgatttatattttgttttctttttattctacaaaatcttagaaaa  13341800
                                           <--------ATHB1
                                           --------->ATHB51
                                           <---------AHL25(3)
                                           -------->HAHB4                              --------->TOE2(3)
                                           <---------ICU4                            --------->ARR11(3)
                                          <---------AHL25(3)                         <---------ARR11(3)
                                          <---------ATHB51                        <---------AHL20(2)
                                          --------->ICU4                          --------->AHL20(2)
                                          --------->AHL20(2)                      --------->AHL20(3)
                                          <---------YAB1                          <---------AHL25(1)
                                          <---------AHL12(3)                      <---------AHL25(2)
                                          --------->AHL25(3)                      <---------AHL20(3)
                                          <---------AHL25(1)                      <---------AHL25(3)
                                          --------->AHL25(1)                      --------->AHL25(2)
                                          <---------AHL20(2)                      --------->AHL25(1)
                                          --------->AHL12(1)                    <---------WOX13(2)
                                         --------->AHL12(2)                     --------->WOX13(2)
                                         --------->AHL25(2)               <-----------GT1
                                         --------->AHL20(3)            <---------AHL12(2)
                                         <---------AHL12(2)           --------->AHL12(1)
                                         <---------AHL20(3)           <---------AHL25(1)
                                    ----------->GT1                   <---------AHL25(3)           -
                                 --------->DOF5.7(1)                  --------->AHL25(1)         ---
                               --------->YAB1                         <---------AHL12(1)     -------
                             <---------AHL12(2)                       --------->AHL20(2)    <-------
                      --------->LBD16    <---------AHL25(2)           <---------AHL20(2)    <-------
                     <---------HSFB2a(2) --------->AHL25(3)           --------->AHL12(3)    <-------
           <-----------GT1  --------->YAB1<---------AHL12(1)          <---------AHL12(3)    --------
      <---------RVE1(2)    --------->AHL20(2)<---------YAB5          --------->AHL25(3)--------->YAB1
   <---------WOX13(1)--------->HSFB2a(2)--------->YAB1        ---------->DOF2 ------>ZmHOX2a(1)  <--
 
tactagattgatattttccttcttccacaaataataaaaacgaaaataattgttgttcatagtataaaagtatttattttcctaataaaatcttaatgat  13341900
                                                                                 ------------>CBF
                                                                                --------->ZAT6
                                                                           <---------ANAC55(2)
                                                                           --------->ANAC55(2)
                                                                         <-----------GT1
                                                                       <---------WOX13(2)
                                                                       --------->WOX13(2)
                                                                      <---------AHL12(2)
                                                                      <---------AHL25(3)
                                                                     <---------AHL12(1)
                                                                     <---------AHL25(3)
                                                                     <---------AHL25(2)
                                                                     --------->AHL25(3)
                                                                     <---------AHL25(1)
                                                                     --------->AHL12(3)
                                                                     --------->AHL25(1)
                                                                     <---------AHL20(1)
                                                                     --------->AHL20(1)
                                                                     --------->AHL20(2)
                                                                     <---------AHL20(2)
                                                                     <---------AHL20(3)
                                                                     --------->AHL20(3)
                                                                     <---------AHL12(3)
                                                                     --------->AHL25(2)
                                                                    --------->AHL25(3)
                                         <------------CBF          <---------WOX13(2)
                                        --------->ATHB12           --------->WOX13(2)
                                        <---------ICU4             <---------AHL12(2)
                                        --------->ATHB51          <---------AHL25(3)
                                       --------->ICU4            --------->AHL25(2)
                                       <---------YAB5            <---------AHL25(3)
                                     --------->YAB1              <---------AHL25(2)
                                    <---------YAB1               <---------AHL25(1)
                                   <-----------GT1               <---------AHL12(3)
                                <---------AHL12(2)               --------->AHL25(1)
          <---------YAB1       <---------AHL12(3)                --------->AHL20(1)
         <---------AHL12(2)    --------->AHL12(3)                --------->AHL20(2)
        --------->AHL20(2)     --------->AHL20(2)                <---------AHL20(2)
        --------->AHL25(1)     <---------AHL20(2)                --------->AHL20(3)
-------->ZAT6                  <---------AHL25(3)                --------->AHL25(3)
------>KAN1            <---------ANAC55(1)  <---------MYB46(3)   <---------AHL12(1)
-->ATHB12--------->AHL12(2)    --------->AHL12(1)                --------->AHL12(1)
--ATHB12--------->AHL12(3)     --------->AHL25(1)               --------->AHL25(3)
--YAB5  <---------AHL20(2)     <---------AHL12(1)       ------->GAMYB--------->AHL12(1)
--YAB1  <---------AHL25(1)     <---------AHL25(1)     --------->At4g35610--------->AHL20(2)
->ICU4 --------->AHL25(3)     --------->AHL25(3)  --------->TOE2(3)--------->AHL12(2)
---------GT1           <---------ANAC46<---------YAB1 <---------At4g35610<---------AHL20(2)
 
ttactctacatttatttttgtatgttaagtgtatttattttcattattggttatctcaactcacagaattaattaattacttaacacaattcttcatttt  13342000
                                                              ---------->DOF2
                                                              --------->MYB52(1)
                                                           -------->P
                                                           ------>MYB46(1)
                                                          --------->MYB55(1)
                                                         --------->DEAR3(1)
                                                         --------->AtMYB61
                                                         <---------MYB111(2)
                                                         <---------MYB111(1)
                                                         <---------MYB46(2)
                                                         --------->MYB46(3)
                                                      --------->AtMYB61
                                                      <---------ALFIN1
                                                   --------->DEAR3(1)
                                                   --------->AtMYB61
                                                   <---------ALFIN1
                               <---------TOE2(3)  --------->MYB46(3)
                             <---------ARR11(2) --------->DEAR3(1)
                           <----------DOF2      <---------ALFIN1
                       --------->TOE2(2)     --------->ANAC46------->GAMYB
                       --------->TOE1(2) --------->At4g35610 --------->AtMYB61
                  --------->At4g35610    ----------->RAV1(2)<---------MYB55(2)
                  <---------At4g35610   ------->TEIL --------->MYB46(3)
           <-----------RAV1(1) <---------TOE1(3)--------->AtMYB61                --------->RVE1(2)
           =======================RAV   <---------GATA12 <---------MYB55(2)--------->ARR11(2)
      --------->AHL20(2)  <---------ANAC46  --------->ZAT18------>MYB83    <---------ARR14(2)
    --------->ANAC58  ----------->RAV1(2)<---------At4g35610--------->MYB46(3)  --------->ANAC46
    --------->ANAC58  <---------ZAT2    --------->GATA12--------->MYB46(3) <---------ARR11(2)
    --------->ANAC46 -------->P--------->MYB59 --------->MYB46(3)          --------->ARR14(2)      <
 
agtccccaagtaatttgttgcagcaacctgcgtttaggttttgcatctgcaccaccaccaccaaccaaaggccttgcatttccacatcaaacgttacgaa  13342100
                                            --------->RVE1(2)
                                   ----------->HVH21
                              ------>ZmHOX2a(2)
                             <------ZmHOX2a(2)
                             <---------GLK1(1)
                            --------->RVE1(2)
                            <---------GATA12<-----------ARR10
                            <---------AGP1  <---------ARR11(2)
                            --------->ARR11(3)                                                 -----
                            <-----------ARR10                                                 <-----
                            <---------ARR11(3)                                               -------
                            --------->ARR14(2)                                               <------
                            <---------ARR11(2)                                               -------
                            --------->ARR11(2)             --------->LBD16                   <------
                            <---------ARR14(2)            --------->ANAC55(2)                -------
                            --------->GATA12--------->ARR11(2)                               -------
                   <---------DOF5.7(1)      <---------ARR14(2)                               <------
                  ==================HOX2a_HOX2a           <---------ANAC46                   <------
                  ===================HOX2a_HOX2a          <---------ANAC55(2)--------->YAB1  -------
               ---------->ID1--------->GLK1(1)         --------->ANAC46     <---------YAB5   <------
           <---------ANAC58 --------->AGP1  --------->ARR14(2)      <----------DOF2    <---------ARR11(2)
           <---------ANAC58<---------CCA1(2)--------->GLK1(2)      <---------DOF5.7(1) --------->ARR11(2)
         ------>NtERF2<-----------GT1       <---------ARR11(3)  ------>ZmHOX2a(2) <---------ANAC46<-
---------RVE1(2)  ------>ZmHOX2a(1)----------->TGA1  <---------ALFIN1       <---------YAB1  <-------
 
gagatttgtctctgccttgtcctcttaaccagatctctctgacgcagtatctgatcacactccgtgatcgtcttttgttatcattttgtgtatcgagatc  13342200
                                                                        ------>ZmHOX2a(2)
                                                                       <------ZmHOX2a(2)
                                                                      --------->ARR14(2)
                                                                      <---------ARR11(3)
                                                                      --------->ARR11(2)
                                                                      --------->ARR11(3)
                                                                      <---------AGP1
                                                                      <---------ARR11(2)
                                                                      --------->RVE1(2)
                                                                      --------->AGP1
                                                                      <-----------ARR10
                                                                      <---------ARR14(2)
                                                                      <---------GATA12
                                                                      --------->GATA12
                                                              <------NtERF2
                                                   <---------ALFIN1  <---------CCA1(2)
                                                   --------->KAN1  <---------HSFB2a(2)
                                                  <---------ZAT18  --------->HSFB2a(2)
                                                  --------->ZAT18<------NtERF2
   --------->ZAT14                              --------->ZAT14 <---------SPL7(1)
   <---------ZAT14                              <---------ZAT14 ------>NtERF2
   --------->ZAT18                              <---------ZAT18<---------ANAC46
->ZmHOX2a(2)                                    --------->ZAT18--------->DEAR3(1)
-ZmHOX2a(2)                                  <---------ANAC46 --------->ATERF1(1)
-->ARR11(3)                                <---------ANAC58   --------->RAP2.3(1)
---ARR11(3)                                ------>ZmHOX2a(2) <---------ORA47(2)
-->ARR11(2)                                <---------ANAC58  <---------ATERF1(1)
---ARR14(2)                               <------ZmHOX2a(2)  ------>NtERF2
-->ARR14(2)                              <---------GATA12   --------->ATERF1(2)
-->AGP1                                  --------->ARR14(3) <---------ATERF1(2)            <--------
---GATA12                                <---------ARR11(3) <---------DEAR3(1)             ---------
---ARR11(2)                              --------->GATA12   --------->DEAR3(1)             ---------
-->GATA12                                --------->ARR14(2)--------->SPL7(1)               <--------
---AGP1                                  --------->ARR11(3)--------->DEAR3(2)         --------->HSFB2a(2)
--------MYB52(1)                         <---------ARR14(2)<---------ABI4(1)          <---------HSFB2a(2)
--GLK1(1)      <---------RVE1(2)         <---------ARR14(3)--------->ATERF1(1)   <---------ATHB12  <
 
tgttagtctactgcgatggctatggaacagaggcctaagacgaagatcgtgtgcacactcgggccggcgtccagatctgtcccaatggtcgagaagcttc  13342300
                                                  --------->RVE1(2)
                                                  --------->ARR11(3)
                                         ------>ZmHOX2a(2)
                                       --------->ARR11(2)
                                       <---------ARR14(2)
                                       --------->GATA12
                                       <---------GATA12
        <---------KAN1                 --------->ARR14(2)
    <------NtERF2                      <---------AGP1
   --------->LBD16                     <---------ARR11(2)
  <---------ANAC58                     <---------RVE1(2)
  <---------ANAC46          <---------DAG2--------->TOE1(2)                           --------->ICU4
  <---------ANAC58      --------->REM1(1)========================HOX2a_HOX2a     --------->ANAC58
 <---------LBD16 <---------ANAC58      <---------ARR11(3)                        --------->ANAC58
-HSFC1(2)        <---------ANAC58      ------->TEIL                           <---------MYB52(1)
>HSFB2a(1)    --------->ALFIN1         --------->ARR11(3) <------ZmHOX2a(1)  <-----------TGA1      <
>HSFC1(2)   <---------ANAC58<----------DOF2       <---------ARR11(3)   --------->GLK1(2)     -------
-HSFB2a(1)  <---------ANAC58<---------DOF5.7(1)  <---------KAN1   <---------ETT(2)    --------->AtLEC2
-----------RAV1(1)    <----------DOF2 <---------CCA1(2)<-----------RAV1(2)   <-----------HVH21     <
 
ttatggcggggatgagcgtggctcgcttcaacttttctcatggatcttacgaatatcaccaggagactctcgacaatcttcgtcaggccatgcttaacac  13342400
              --------->KAN1
            <-----------HVH21
           --------->bZIP60(1)
           <---------bZIP60(1)                                <---------AHL20(2)
 --------->ANAC58                                             --------->AHL20(2)
 --------->ANAC58                --------->WOX13(1)           <---------AHL20(3)                  <-
---------ANAC58         ------>NtERF2           <-----------HVH21          --------->YAB1  <--------
-->ZAT6  --------->At4g35610   --------->WRKY18(1)            --------->AHL20(3)           <--------
---------ANAC58     --------->ANAC46--------->TOE2(3)    <-------TEIL      <-----------GT1 <--------
 
tggcatgctatgtgctgtcatgctcgacaccaaggtcaatcttataaaacttgtcatatgtgcatttttatgtctgtataacaatgccatcgaggcgttt  13342500
                                                                                             -------
                                                                                            --------
                                                                                            <-------
                                                                                            <-------
                                                                                            <-------
                                                                                            --------
                             <---------YAB1                                             <---------At4g35610
                         <---------GLK1(2)                                              <---------ZAT2
                        --------->YAB5                                          --------->KAN4(2)  <
                       <---------KAN1                                          --------->KAN1<------
   <---------RVE1(2)   <---------YAB5                                       <------MYB46(1) --------
  --------->ATHB12     <---------YAB1                                       <---------MYB46(3)------
 <---------YAB1    --------->ANAC58                                         ----------->GT1 <-------
---------DOF2      --------->ANAC46              <-----------GT1            <------MYB83--------->At4g35610
-ANAC58            --------->ANAC58         --------->YAB1                <---------WOX13(1)--------
-ANAC46         --------->ZAT14            <---------ATHB12             --------->ATHB12--------->ZAT2
-ANAC58         <---------REM1(2)------>ZmHOX2a(2)         <-------TEIL<---------YAB1----------->RAV1(2)
 
tcttttgatttgggctctgttcacgcatgattctgatcgtttctctatcattttacaagtgattcatgtcttatctgattggttattcccctgctgatct  13342600
 --------->KAN1
--------->ZAT18
<---------ZAT18
-->At4g35610
->RVE1(2)
--ARR11(2)                                                      <-----------GT1
--GATA12                                                    <---------MYB52(1)
--ARR14(2)                                               --------->SPL7(1)
->ARR11(2)                                               <-------TEIL
------ZmHOX2a(1)                                       <---------SPL7(1)                      <-----
---At4g35610                  <---------ZAT18      <---------ANAC46                        <--------
->ARR14(2)                    --------->ZAT14      <---------ANAC58                        ---------
>ZmHOX2a(2)                ------>ZmHOX2a(1)       <---------ANAC58                        ---------
--RVE1(2)        --------->YAB5   <----------DOF2  <---------AtLEC2--------------->AGL15   <--------
->GATA12        <---------YAB1<---------ZAT14 <-----------RAV1(1) ----------------->AGL1   ---------
 
gaggacactcgttttggctatgtttaagtcctgtgaactttggtataatttgtggcatggtacgttgtttccagttcgagcatgaattagacaatatctg  13342700
<- Previous    Next ->

AGI:  At4g26390.1   
Description:  pyruvate kinase, putative. Identical to Probable pyruvate kinase, cytosolic isozyme [Arabidopsis Thaliana] (GB:O65595); similar to pyruvate kinase, putative [Arabidopsis thaliana] (TAIR:AT5G63680.1); similar to pyruvate kinase, putative [Arabidopsis thaliana] (TAIR:AT5G56350.1); similar to pyruvate kinase, putative [Arabidopsis thaliana] (TAIR:AT5G08570.1); similar to pyruvate kinase [Glycine max] (GB:CAI53675.1); similar to Pyruvate kinase, cytosolic isozyme (PK) (GB:Q42954); similar to hypothetical protein [Vitis vinifera] (GB:CAN70030.1); contains InterPro domain Pyruvate/Phosphoenolpyruvate kinase, catalytic core; (InterPro:IPR015813); c
Range:  from: 13342216    to: 13344427    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version