AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                             --------->ANAC46
                            <---------LBD16
                            --------->At4g35610
                            <---------At4g35610     <---------ZAT18
                            ------>NtERF2 <---------ANAC46
                            --------->LBD16<---------SPL7(1)
                          <---------LBD16 <---------ANAC58
                         ------>ZmHOX2a(1)<---------ANAC58
                        <---------ALFIN1 <------NtERF2  <----------DOF2
                     <---------ALFIN1   <------------------SPL14
                    <---------At4g35610 <---------ORA47(2)
                <-----------HVH21      <---------RAP2.3(3) --------->HSFB2a(2)
               <----------DOF2         <---------DEAR3(1)  <---------HSFB2a(2)                ------
     <------NtERF2<-----------GT1  --------->KAN1---------->DOF2                           ---------
--->WOX13(1)<---------ARR11(3)  <---------ARR11(2)  --------->ZAT18 ----------->GT1  --------->ZAT14
--YAB1      --------->ARR11(3)--------->LBD16--------->SPL7(1)   <------NtERF2  <---------RAP2.6(3)-
 
tcttcggcatcgggacatctttcacctcctccgcggaaatagtcggcgtacggagagcgcttctagtcggagagagaaatagccgtagtgaagacgatga  13336000
                                                                                           <--------
                                         <------NtERF2                                     ---------
                                        --------->LBD16                         --------->ARR14(2)
                                        <------NtERF2                           <---------ARR14(2)
                                       <---------DEAR3(1)                       --------->GLK1(2)
                   --------->ANAC58   <---------LBD16                           --------->ARR11(2)
             <---------MYB52(1)    --------->WRKY38(1)                          <---------ARR11(2)
             <-----------HVH21    <---------MYB52(1)                            --------->GATA12
 --------->YAB5    --------->ANAC58--------->WRKY12 --------->MYB46(3)          <---------GATA12
<---------KAN1--------->SPL7(1)  <-------GAMYB  <---------KAN1            --------->At5g28300
--->YAB5<-----------GT1         <---------MYB46(3) -------->P<---------GATA12  <---------GLK1(2)
>YAB5  <-----------GT1          --------->MYB52(2)--------->WOX13(1)     ----------->GT1  <---------YAB5
------>TEIL <---------SPL7(1)  <-------TEIL    --------->RVE1(2) ------>ZmHOX2a(1)  ----------->GT1
 
cgaacgtttatttcccgttcgcagggaaaccaagttcgttggccggagcgaatcaaccaatgtaaatcctatagaacggtgagaatctggtgaaacatta  13336100
                                        <---------ANAC46                        <---------At4g35610
                                       <------NtERF2                      <---------DOF5.7(1)
                                     <---------DEAR3(1)                  --------------------->WRI1
                                 ---------->DOF2    --------->ANAC46     <----------DOF2
                              --------->ANAC58--------->HSFC1(2)         <---------DOF5.7(1)
                     >>>>>>>>>TBF1 --------->DOF5.7(1)                  <---------DOF5.7(1)
               <-------TEIL   --------->ANAC58--------->HSFB2a(1)     <---------ARR11(3)
-ICU4       --------->KAN1--------->ANAC58    <---------HSFB2a(1) <---------ANAC58             <----
>YAB5 --------->MYB52(1)  --------->ANAC58    <---------HSFC1(2)  <---------ANAC58     <---------ANAC46
 
ctggagaagtaacagaggttcgaagaagaacgtaagcaaagcggcgagaaggttccctccatttttgtttcgagctctttttctgcttcgccgtgttagt  13336200
                                                           ----------->GT1
                                                           <------ZmHOX2a(1)
                                                           --------->YAB5
                                                         ------------------------>ANAC81
                   --------->LBD16                      --------->DOF5.7(1)
                  --------->ANAC46                     ---------->DOF2
                  ----------->GT1                      --------->DOF5.7(1)               <---------At4g35610
                  --------->TOE2(3)               ----------->GT1                        --------->At4g35610
               --------->ARR11(2)                 --------->LBD16                       --------->GLK1(2)
               <---------ARR14(2)                --------->HSFB2a(2)                 --------->DOF5.7(1)
               <---------ARR11(2)                --------->ANAC46                  ---------->DOF2--
               --------->ARR14(2)               <---------LBD16      xxxxxxxxxxxxxxxxxxxx>smallRNA(le3)
              <---------GLK1(1)             --------->RVE1(2)       xxxxxxxxxxxxxxxxxxxx>smallRNA(le3)
              --------->KAN1                <---------ARR11(3)     xxxxxxxxxxxxxxxxxxxx>smallRNA(le3)
              --------->GLK1(1)             --------->ARR11(3)     xxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
          <---------TOE2(3)           *TSS --------->RVE1(1)      xxxxxxxxxxxxxxxxxxx>smallRNA(si3)
         <---------DOF5.7(2)       <----------ID1<---------HSFB2a(2)xxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
      --------->At4g35610 ----------->GT1  --------->CCA1(1)------------------------>ANAC81      ---
-----ZAT6--------->MYB52(1)      <---------AHL12(2)   --------->DOF5.7(1)          --------->DOF5.7(1)
 
gtgagaagcagataacgatatccgtaaaattgaaaaaaaaaacaaaatatctccggaaaaaaggattaaaaaaaaaaaaaaaaaaaaaaagaagctgaaa  13336300
                                                                                                   <
                                                                                                   <
                                                                                                   <
                                                                                                   -
                                                                                                   -
                                                                                                   <
                                                                                                   <
                                                                                                   <
                                                                                                   <
                                                                                                   -
                                                                                                  <x
                                                                                                  <x
                                                                                                  <x
                                                                <-----------HVH21                 <x
                                                               <xxxxxxxxxxxxxxxsmallRNA(se3)      <x
                                                              --------->TOE1(2)                   <x
                                                              --------->TOE2(2)                   --
                                                             ----------->RAV1(2)                 <xx
                                                       <---------GATA12                          <xx
                                                       --------->GATA12                          <xx
                                                      <xxxxxxxxxxxxxxxxsmallRNA(se3)             <xx
                                                    <xxxxxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)     <xx
                                                   <xxxxxxxxxxxxxxxxsmallRNA(s)                  ---
                                                  <xxxxxxxxxxxxxxxxsmallRNA(s)                  ----
                                                 <xxxxxxxxxxxxxxxxsmallRNA(s)                   <xxx
                                               <---------ARR11(2)                               <xxx
                                               --------->ARR11(2)                              <xxxx
                                            <-----------------AGL1                             <xxxx
                                            ----------------->AGL1                             <xxxx
                                            <---------ANAC46 <---------KAN1                    <xxxx
                                           <xxxxxxxxxxxxxxxxxxxxxsmallRNA(l2)                <xxxxxx
--------->ANAC46                           <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(l2)      --------->ANAC58
--------->ANAC58             --------->ANAC58  <---------ARR14(2)----------->HVH21   --------->ANAC46
--------->ANAC58             --------->ANAC58  <xxxxxxxxxxxxxxxxsmallRNA(s)          --------->ANAC58
------->ANAC46             ---------->DOF2--------->ZAT18------>ZmHOX2a(2)       <xxxxxxxxxxxxxxxxxx
------>TOE1(2)      --------->YAB1     <-----------RAV1(1)  ------->TEIL     --------->KAN1  <xxxxxx
 
cacacgacaacgttttagtctgatcaaaatgaaagccaaaaaatgtggcctatacagggatcgaacctgtgaccttcgcgttattagcacgacgctctaa  13336400
             --------->ZAT18
             <---------ZAT18
           --------->ANAC58
    <---------At4g35610
    --------->At4g35610
   <xxxxxxxxxxxxxxxsmallRNA(fl3)
   <xxxxxxxxxxxxxxxsmallRNA(le3)
   <xxxxxxxxxxxxxxxsmallRNA(se3)
   <xxxxxxxxxxxxxxxsmallRNA(si3)
  <xxxxxxxxxxxxxxxxsmallRNA(i)
  <xxxxxxxxxxxxxxxxsmallRNA(s)
  <xxxxxxxxxxxxxxxxsmallRNA(se3)
  <xxxxxxxxxxxxxxxxsmallRNA(fl3)
 <xxxxxxxxxxxxxxxxxsmallRNA(si3)
 <xxxxxxxxxxxxxxxxxsmallRNA(se3)
 <xxxxxxxxxxxxxxxxxsmallRNA(fl3)
 <xxxxxxxxxxxxxxxxsmallRNA(s)
<xxxxxxxxxxxxxxxxxxsmallRNA(se3)
<xxxxxxxxxxxxxxxxxxsmallRNA(si3)
<xxxxxxxxxxxxxxxxxxsmallRNA(fl3)
xxxxxxxxxxxxxxxxxxxsmallRNA(se3)
xxxxxxxxxxxxxxxxxxxsmallRNA(i2)
xxxxxxxxxxxxxxxxxxxsmallRNA(si3)
----->MYB83--------->ANAC46
----->MYB46(1)
xxxxxxxxxxxxxxxsmallRNA(le3)
xxxxxxxxxxxxxxxxxxxsmallRNA(fl3)
xxxxxxxxxxxxxxxxxxxsmallRNA(le3)
xxxxxxxxxxxxxxxxxxxsmallRNA(s2)
---------->RAV1(2)
xxxxxxxxxxxxxxxxxxxsmallRNA(i2)
xxxxxxxxxxxxxxxxxxxsmallRNA(s2)
xxxxxxxxxxxxxxxxxxxsmallRNA(le3)
xxxxxxxxxxxxxxxxxxxsmallRNA(fl3)
xxxxxxxxxxxxxxxxxxxsmallRNA(se3)
xxxxxxxxxxxxxxxxxxxsmallRNA(si3)
------->MYB52(1)
xxxxxxxxxxxxxxxxxxxsmallRNA(i2)
xxxxxxxxxxxxxxxxxxxsmallRNA(fl3)
xxxxxxxxxxxxxxxxxxxsmallRNA(le3)
xxxxxxxxxxxxxxxxxxxsmallRNA(si3)
xxxxxxxxxxxxxxxxxxxsmallRNA(se3)
---->GAMYB --------->ANAC58               <---------RVE1(1)         <---------YAB1
----->MYB46(3)                            <---------CCA1(1)     <---------RVE1(2)
xxxxxxxxxxxxxxxxxxxsmallRNA(i2)          <---------ARR11(3)     <------------CBF
xxxxxxxxxxxxxxxxxxxsmallRNA(si3)         <---------RVE1(2)    <---------TOE1(2)
xxxxxxxxxxxxxxxxxxxsmallRNA(se3)         --------->ARR11(3)   <---------TOE2(2)
xxxxxxxxxxxxxxxxxxxsmallRNA(si3)       ----------->ARR10   <---------ANAC58
xxxxxxxxxxxxxxxxxxxsmallRNA(i2)  --------->ZAT18           <---------ANAC46                      ---
xxxxxxxxxxxxxxxxxxxsmallRNA(s2)  <---------ZAT18           <---------ANAC58 ----------->HVH21    ---
xxxxxxxxxxxxxxxxxxxsmallRNA(se3) <---------ZAT14        <---------KAN1<---------RVE1(2)          <--
xxsmallRNA(fl3)   *TSS       --------->ALFIN1         <---------GLK1(2)--------->GLK1(2)         ---
xxxxxxxxxxxxxxxxxxxsmallRNA(si3) --------->ZAT14  <---------LBD16   <---------YAB5     <----------DOF2
 
ccaactgagctaataggccactacgtttctaagtggtgcacttagatatttctctcggaatttcgtagattgtgattctgtgacagttttctttcaagac  13336500
         ----------->RAV1(1)
        <----------ID1    --------->CCA1(2)              --------->AHL12(2)
       --------->ZAT18    <---------KAN1                 <---------WOX13(2)
--------->RVE1(2)        <---------RVE1(2)               <---------AHL12(2)
------>ANAC58            --------->ARR11(2)              --------->WOX13(2)                 --------
------>ANAC58            <---------ARR14(2)           --------->ARR11(3)                   <--------
-------ANAC55(2)         <---------ARR11(2)           <---------ARR11(3)                   ---------
------>ANAC55(2)         --------->ARR14(2)         ----------->GT1    <-----------GT1     <--------
 
aagtatcaagtgcaacaaaaaaacatcggatatgggactcgtactcgtgttcatgaagataataaactctcatataactacttgactaaaacgatatatt  13336600
                                                                                                <---
                                                                                                ----
                                                                                             <------
                                           --------->ATHB12                              xxxxxxxxxxx
                                           --------->YAB5                               ------->GAMYB
                                          <---------YAB1                         <---------ZAT6-----
                                          --------->ICU4                       <xxxxxxxxxxxxxxxxsmallRNA(s)
                                        --------->ANAC55(2)                   <xxxxxxxxxxxxxxxxxxxxx
                                        <---------ANAC55(2)                   <xxxxxxxxxxxxxxxxxxxxx
                                   --------->ANAC46             --------->MYB52(1)   <---------DOF5.7(2)
->KAN1                             --------->YAB1               <-----------GT1xxxxxxxxxxxxxxxxxxxxx
-AHL20(1)                          <---------ICU4             <---------MYB52(2) <xxxxxxxxxxxxxxxxxx
>ARR11(3)                         <---------YAB5      <-----------GT1      <-----------GT1 ---------
-ARR11(3)                     --------->WOX13(2)<---------TOE2(3)<---------TOE2(3) --------->DOF5.7(2)
 
cgtatgcattagaaaaaacaattgtatataactaataaacatcacatgattaagttttaactgcaaataacgattttgttaccactgttaacgctcgtta  13336700
                                      --------->AHL25(1)
                                      <---------AHL25(3)
                                      --------->AHL12(1)
                                      <---------AHL12(1)
                                      <---------AHL25(1)
                                      <---------AHL12(3)
                                      --------->AHL20(2)
                                      --------->AHL12(3)
                                     --------->AHL25(2)
                                     <---------ARR11(3)
                                     <---------AHL25(2)
                                     <---------AHL12(2)
                                     --------->AHL20(1)
                                     --------->ARR11(3)
                                     --------->AHL12(2)
                                     --------->AHL12(1)
                                     --------->AHL25(3)
                                     <---------AHL12(1)
                                     <---------AHL20(1)
                                    <---------AHL25(2)
                                    --------->AHL12(3)
                                    --------->AHL12(2)
                                    <---------AHL12(3)
                                  <---------AHL12(3)
                                  <---------AHL20(3)
                                  --------->AHL20(2)
                                  --------->AHL12(3)
                                  --------->AHL20(3)
                                  --------->AHL25(2)                                              <-
                                 --------->YAB1                                                   <-
                                 <---------AHL25(3)                                              ---
                                --------->AHL20(2)                                               ---
                              <---------AHL12(2)                                                ----
                           <---------AHL12(2)                                                 <-----
                           --------->AHL12(2)                                                <------
   <---------KAN1         <---------AHL25(3)                                                 -------
------WOX13(2)           --------->AHL20(2)                                                  -------
----->WOX13(2)         <---------AHL12(2)                                    xxxxxxxxxxxxxxxxxxxxxxx
---MYB52(1)          --------->AHL12(3)                                    <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)
xxxxx>smallRNA(i)    --------->AHL20(2)                          --------->ANAC55(2)         <------
---->KAN1            --------->AHL25(1)                         --------->MYB59              <------
xxsmallRNA(si3)      <---------AHL12(3)                         <---------TOE2(3)          <xxxxxxxx
xxsmallRNA(fl3)      <---------AHL20(3)   <---------AHL20(2)<---------WOX13(2)            --------->ANAC58
xx>smallRNA(i2)      --------->AHL25(2) <---------AHL12(2)<---------------AGL15           --------->ANAC58
xxxxxsmallRNA(fl3)   --------->AHL20(3)<---------AHL25(3) --------------->AGL15          <---------LBD16
-->GT1   <---------RVE1(2)--------->AHL20(2)---------->DOF2 --------->WOX13(2)          <xxxxxxxxxxx
 
attcggatgtctgattttgtcaaaaaaaataaaaaataaaaatatttaaaagacataaaaactaatttaggtattttggacaaatttagtagcacggata  13336800
                         <---------ARR11(3)
                         --------->ARR11(3)
                 <---------AHL25(3)
                 <---------AHL20(2)
                <---------AHL12(3)
                --------->AHL25(1)
                <---------AHL25(1)
            <---------YAB1
           <---------AHL25(3)
           --------->AHL20(2)
           <---------AHL20(2)
           --------->AHL25(2)
           <---------AHL25(2)
          --------->AHL20(2)
        --------->WOX13(2)
      xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)
     <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)
--------AHL20(2)<---------AHL20(2)
--------AHL25(3)--------->AHL25(3)
------>AHL25(3) --------->AHL20(2)                                                   <----------DOF2
------>AHL20(2) <---------AHL25(3)                                    <---------AHL12(3)
----->AHL12(2)<---------WOX13(2)                      --------->TOE2(3)<---------AHL25(3)
----KAN1<---------WOX13(2)                          ------>MYB46(1)   --------->AHL12(3)
---RVE1(2)<---------AHL25(3)                       --------->ORA47(1) --------->AHL25(1)
-->ARR11(2)<---------AHL25(1)       <---------DOF5.7(1)  --------->WOX13(2)         <---------DOF5.7(1)
-->ARR14(2)--------->AHL25(1)      <----------DOF2--------->DEAR3(1)  --------->AHL25(3)
>smallRNA(fl3)--------->WOX13(2)   <---------DOF5.7(1)<---------MYB59 <---------AHL20(2)           <
---ARR14(2)--------->AHL12(3)      <---------DAG2--------->MYB46(3)   <---------AHL25(1)           <
---ARR11(2)<---------AHL12(3)    <---------At4g35610------>MYB83      --------->AHL20(2)           -
xxxxxxxxxxxxxxxsmallRNA(se3) <-----------GT1     --------->DEAR3(2)  --------->AHL12(2)  <----------
xxxxxxxxxxxxsmallRNA(le3)<---------RVE1(2)    ---------->DOF2       <---------KAN1<---------ARR11(3)
 
ttaaataggcaaattaaaattaaatggagatttttcagcttttttcccataaaccgacctaaataactcgaatataaattgtcatgaccttttaacatcg  13336900
<- Previous    Next ->

AGI:  At4g26370.1   
Description:  antitermination NusB domain-containing protein. similar to unnamed protein product [Vitis vinifera] (GB:CAO22120.1); contains InterPro domain NusB/RsmB/TIM44; (InterPro:IPR006027)
Range:  from: 13333733    to: 13336239    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At4g26375.1   
Description:  pre-tRNA. tRNA-Ile (anticodon: AAT)
Range:  from: 13336346    to: 13336419    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version