AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
           ------>ZmHOX2a(1)
         ------>ZmHOX2a(2)
       --------->AGP1
       <---------ARR14(3)
       <---------GLK1(2)
       --------->ARR11(3)
       <---------ARR11(3)
       --------->ARR11(2)
       <---------ARR14(2)
       --------->ARR14(2)
       <---------ARR11(2)
       --------->ARR14(3)
       --------->GATA12                             --------->ARR11(3)
       <---------GATA12                             --------->ARR14(2)
     ----------->ARR10                              <---------ARR11(2)
   <------NtERF2                                    <---------ARR14(2)
   --------->ATERF1(1)                              <---------RVE1(2)
  ------>NtERF2                          --------->YAB5
  ----------->RAV1(1)            ---------->DOF2    <---------GLK1(2)
------->DOF5.7(1)       <----------DOF2 --------->MYB46(3)                       --------->ANAC46
------>DOF2--------->LBD16   --------->HSFB2a(2)    --------->ARR11(2)           --------->ANAC58
---->RAV1(1)           <---------DOF5.7(1)  <---------ATHB12                     --------->ANAC58  -
->ANAC46<------ZmHOX2a(2)    <---------HSFB2a(2)   <---------At4g35610     <-----------GT1        --
 
aaaggcgccagatcctgaaacaattctcttttctacaaaagaaaccactaattcagatactgaaccaagttcccaaattcacatactcaacacaatttga  7273600
                                              <---------------------WRI1
                                            --------->WRKY45
                                            ----------->HVH21
                                            --------->WRKY12
                                           --------->DOF5.7(2)
          --------->TOE2(3)              <---------MYB46(3)
          <----------DOF2         <---------STY1(1)
  <---------ARR11(3)            --------->TOE1(3)  <---------KAN1        <-----------RAV1(2)
  --------->ARR11(3)           --------->ZAT6<---------DOF5.7(2)      --------->ZAT18
-------->DAG2                <-----------GT1--------->WRKY38(1)--------->MYB52(1)                  -
-------->DOF2               <---------KAN1<-------GAMYB       --------->DOF5.7(1)          >>>>>>>>>TBF1
 
gaaaagttctcaactttagcaaatttcaagagtaaccctagcgctcgttgacgaatcagacaaaaaaaacgactgcccagatggaagaaatgaagaagaa  7273700
                                                                              ------>MYB46(1)
                                                                    <------ZmHOX2a(2)
                                   --------->DOF5.7(1)             --------->GATA12      --------->At4g35610
                          <---------HSFB2a(1)                      <---------GATA12   <---------At4g35610
                   --------->TOE1(2)                           XXXXXXXXXXXXXXXXXXXX>MIR832-5P
                   --------->TOE2(2)                          <---------ANAC46------>MYB83
          <---------YAB1---------->DOF2                      <---------At4g35610      --------->ZAT2
         --------->AHL20(3)    --------->HSFB2a(2)           --------->At4g35610      <---------ZAT2
         <---------AHL20(3)    <---------HSFB2a(2)       ==================HOX2a_HOX2a--------->At4g35610
-------->TOE1(2)   --------->TOE2(3)                     <------ZmHOX2a(1)  --------->MYB46(3)
 
aacatgagagattataagaaaaccttggaaagctcgagaagagcattttctctgagttcaggattgctgagatcgagtaccaactgttcagcagaggcca  7273800
                   <---------GLK1(1)
                   <---------At4g35610
                   --------->ZAT2                                                            -------
                   --------->GLK1(1)                                                         -------
                   <---------ZAT2                                                           <-------TEIL
                 <------NtERF2                                                             ---------
                <------NtERF2 --------->ARR11(3)                  <---------ZAT18         <---------ARR11(2)
                --------->LBD16                                   --------->ZAT18         <---------RVE1(2)
               <---------DEAR3(1)                              <---------ANAC58           <---------ARR14(2)
              <---------LBD16 <---------RVE1(2)                --------->ALFIN1           --------->ARR11(1)
        <-----------RAV1(1)  <------ZmHOX2a(1)       --------->AtMYB61                    <---------GATA12
      <----------DOF2       <------MYB46(1)          <---------ALFIN1                     --------->ARR11(2)
     ------>ZmHOX2a(2)      <------MYB83 <---------DEAR3(1)    <---------ANAC58           --------->GATA12
     <---------DOF5.7(1)  <--------P     <---------AtMYB61  --------->DAG2                <---------GLK1(2)
     ===============================HOX2a_HOX2a     --------->MYB46(3)                    --------->ARR14(2)
    <------ZmHOX2a(2)    <---------MYB52(1) --------->ALFIN1--------->DOF5.7(1)          --------->KAN1
    ================================HOX2a_HOX2a   <------ZmHOX2a(1)                     <-------TEIL
   --------->GATA12--------->At4g35610   --------->ALFIN1 ---------->DOF2               ----------->ARR10
   <---------ARR11(3)   --------->LBD16--------->LBD16--------->MYB52(1)               <--------P
   --------->ARR11(3) <---------LBD16<---------LBD16<---------ABI4(2)                ----------->GT1
 
aattgcgatctttgttggccggagctccggtaggattttgtgcggaggtgctaggaccaccgaaaggtgtgcccatggagagagaagaaggtagattcgc  7273900
                                                            <---------DOF5.7(1)
                                                     --------->ARR11(2)                          <--
                                                --------->ARR14(1)                               <--
                                               --------->ARR14(2)                               <---
                                               --------->ARR11(1)                              <----
                      <---------MYB46(3)       <---------GLK1(2)                           ---------
            <<<<<<<<<MYB2                      <---------ARR14(2)                          ---------
        <--------P   <---------TOE1(2)         --------->ARR11(2)                       --------->ARR14(2)
    --------->LBD16 <---------MYB52(1)<----------DOF2--------->ARR14(2)                 --------->ARR11(2)
-->ANAC58 <------MYB83--------->MYB52(2)       <---------ARR11(2)                       <---------ARR14(2)
-->ANAC58 <------MYB46(1)      <---------WOX13(2)   *TSS<-----------GT1   <----------DOF2  ---------
>ARR14(1)<---------AtMYB61<---------MYB46(3)<---------TOE2(3) <---------DOF5.7(1)       <---------ARR11(2)
 
cattctccagagttggttttctcgtttgtttgttaatgggacttttcaaggattcggtttctcccttcttctctcttctttatagatggcgattacgccc  7274000
                    <---------AtLEC2
              --------->AHL12(1)
              <---------AHL25(3)
              <---------AHL12(3)
              --------->AHL25(1)
              <---------AHL25(1)
              <---------AHL12(1)
              --------->AHL12(3)
              --------->AHL20(2)
             --------->AHL25(3)
             <---------AHL20(2)
           --------->AHL12(2)
           <---------AHL12(2)
          --------->AHL20(3)
          <---------AHL12(3)
          --------->AHL25(1)
          <---------AHL20(3)
          <---------AHL25(3)
          --------->AHL12(3)
          --------->AHL12(1)
          <---------AHL20(2)
          <---------AHL25(1)
          --------->AHL20(2)
          <---------AHL12(1)
     ------>ZmHOX2a(1)
    --------->TOE2(3)
-------DOF5.7(1)  <-----------GT1                                          <-----------GT1
--------DOF2--------->AHL12(2)           --------->YAB5            <---------YAB1             <-----
------DOF5.7(1)<---------AHL12(2)   --------->AHL25(2)           --------->YAB5              <------
-----DOF5.7(1)<---------AHL20(2)    <---------AHL25(1)           <---------ICU4              -------
>ANAC46  --------->AHL25(3)         <---------AHL25(2)           --------->YAB1             --------
>ANAC58  <---------AHL20(2)         <---------AHL12(3)          <---------YAB5            <---------DOF5.7(1)
>ANAC58 --------->AHL12(2)          --------->AHL20(2)          <---------ATHB12         <---------MYB52(1)
 
ctttcttccttatttatttattttcatgtcaaaacaaaaaaaaatgtttagtttcaaaatagttttaatcatcactatttacgacttaaaccgtttttta  7274100
               --------->YAB1
              <---------YAB1
             <---------AHL25(2)
             --------->AHL25(2)
             <---------AHL20(3)
             --------->AHL20(2)
             --------->AHL20(1)
             <---------AHL20(2)                                                 <---------WOX13(2)
         --------->AHL12(2)                                     <---------WOX13(1)
        --------->AHL20(2)                                     <---------WOX13(2)   ----------->GT1
     --------->YAB1     <---------YAB5                         --------->WOX13(2)   <---------TOE2(3)
    <---------YAB5      <---------ZAT6                    ----------->GT1<---------ZAT18
----AHL20(2) --------->AHL20(3)                           <---------ZAT6 --------->ZAT18
---AHL20(2) --------->YAB1        ----------->GT1   --------->DAG2     <---------------AtSPL8
-->AHL25(3) <---------AHL25(3)  ------->MYC3       ---------->DOF2     --------------->AtSPL8
->AHL12(2)<---------AHL12(2)    <-------MYC3--------->AHL20(2)--------->ATHB12  --------->WOX13(2)
 
tttgttattcataaattataatatgtagtgatgcatatggtaaacaaataaacaaaaagtagtgttaattggtttgtgtacaaaattaagttataagtta  7274200
                                                                                                   -
                                                                                                  <-
                                                                            <---------TOE2(3)     --
                               --------->ANAC46                        --------->YAB5        -------
                               --------->ANAC58                       <---------YAB1        <-------
                           <---------YAB1                            <---------ARR11(3)--------->ATHB12
                        <---------AHL12(1)                           --------->ARR11(3)-------->ATHB1
                        --------->AHL20(2)                        --------->AHL20(2)   <---------ICU4
                        <---------AHL20(2)                        <---------AHL20(3)   --------->YAB1
                      --------->WOX13(2)                          <---------AHL25(3)   --------->YAB5
                      <---------WOX13(2)                          --------->YAB1      <---------ATHB12
                 <---------GLK1(1)               --------->ANAC58 <---------AHL25(1)  <---------YAB5
             --------->ANAC58  --------->ANAC58  --------->ANAC58 --------->AHL20(3)  <---------YAB1
             --------->ANAC58---------->DOF2 --------->ANAC58     --------->AHL12(3)  --------->ICU4
      ------->TEIL <---------ATHB12          --------->ANAC46     <---------ICU4   <---------AHL20(2)
   <---------YAB1--------->GLK1(1)           --------->ANAC58  --------->YAB1    --------->AHL12(2)<
 
aacaacatgaatgtgaacggaaatcaatttatcaaagcaatggcacataagcaagaaatagttctctaataatatcattaagttttttaatcattgatgt  7274300
                                        --------->AHL20(1)
                                        <---------AHL25(1)
                                        --------->AHL25(2)
                                        <---------AHL25(2)
                                        <---------AHL25(3)
                                        --------->AHL20(2)
                                        <---------AHL20(2)
                                        --------->AHL12(1)
                                        <---------AHL12(1)
                                       <---------AHL12(3)
                                       --------->AHL25(1)
                                       --------->AHL25(2)
                                       <---------AHL25(2)
                                       <---------AHL25(1)
                                       --------->AHL25(3)
                                       --------->AHL12(3)
                              <---------AHL12(2)
                              --------->AHL12(3)
                              <---------AHL12(3)
                              --------->AHL25(2)
                             --------->ARR11(3)
                             <---------ARR11(3)
                             <---------AHL12(2)
                             --------->AHL12(1)
                             --------->AHL12(2)
                             <---------AHL20(1)
                             --------->AHL25(2)
                             <---------AHL25(2)
                             <---------AHL25(3)
                             --------->AHL20(1)
                             <---------AHL12(1)
                            --------->AHL12(3)
                            --------->AHL25(3)
                            <---------AHL25(1)
                            <---------AHL12(3)
                            --------->AHL25(1)
                            <---------AHL25(3)
                            --------->AHL12(1)
                            <---------AHL12(1)
                           --------->AHL12(1)
                           <---------AHL25(2)
                           <---------AHL12(1)
                           --------->AHL12(2)
                           --------->AHL25(3)
       --------->KAN1      --------->AHL25(2)
 --------->RVE1(2)         <---------ARR11(3)                               --------->TOE2(2)
--------->RVE1(1)          --------->ARR11(3)                               --------->TOE1(2)
-------->AHL12(1)          <---------AHL20(3)                              ----------->GT1
--------AHL12(2)           --------->AHL20(1)                    --------->ANAC46--------->ARR11(3)
------->AHL12(2)           --------->AHL20(3)              <---------KAN1  <---------ANAC55(2)
---->GT1                   <---------AHL20(1)   <---------WRKY18(1)        --------->ANAC58
--TOE2(3)       ----------->RAV1(1)    --------->AHL20(2) ------->TEIL     --------->ANAC58
---------AHL12(1)       --------->AHL20(2)     --------->WRKY38(1)    --------->AtMYB61  --------->ZAT6
 
aaaatatcacatatgagtccaacataagaaaatatttttaaaaaaaattgttgactgaacgaatttagacggaccaaaacgtaagaactcgaacactaaa  7274400
               --------->ARR14(2)
               <---------ARR14(2)
               --------->ARR11(2)
       <---------AHL12(1)
       --------->AHL12(1)                --------->HSFB2a(2)                                       <
      --------->WOX13(2)             <---------ANAC58                                          <----
     --------->AHL12(2)              <---------ANAC58                                          -----
   <---------AHL12(3)               xxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)                       -----
   --------->AHL20(2)               <---------HSFC1(2)                                         <----
   <---------AHL20(2)          --------->MYB46(3)     <---------AHL20(2)                       -----
   --------->AHL12(3)          <------------AtMYB77 <---------AHL12(2)                         -----
   --------->AHL25(1)        --------->ARR11(2)    --------->YAB1                              <----
   --------->AHL25(3)        <---------ARR11(2)   --------->AHL20(2)                      ----------
   <---------AHL25(1)  <---------ARR11(2)<---------HSFB2a(2)     ---------->DOF2--------->DAG2 -----
<---------GATA12    <---------ANAC46--------->HSFB2a(1)---------->DOF2<----------DOF2---------->DOF2
--------->GATA12--------->CCA1(2)   --------->HSFC1(2)--------->AHL20(2)       ---------->DOF2 <----
 
tgagatttaaattttcaagataggcgtaaatgtaaccgatgcttctgaaacaaataataaaagagttagaaagctttataagaaaagtacaagcggaaaa  7274500
<- Previous    Next ->

AGI:  At3g20800.1   
Description:  rcd1-like cell differentiation protein, putative. similar to rcd1-like cell differentiation protein, putative [Arabidopsis thaliana] (TAIR:AT5G12980.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO38914.1); contains InterPro domain Cell differentiation proteins, Rcd1-like (InterPro:IPR007216)
Range:  from: 7271143    to: 7273953    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version