AthaMap TU-Logo
Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                         <---------ICU4             ------->GAMYB
                                                        <---------YAB1           ----------->RAV1(1)
                                        --------->GATA12<---------YAB5        <---------HSFB2a(2)
                                        --------->ARR14(2)                  --------->At4g35610
                                        <---------ARR14(2)                <---------ANAC58
     <---------At4g35610       --------->DOF5.7(1)      --------->ICU4    <---------ANAC58
---------->RAV1(2)        <---------TOE2(3)           --------->YAB1     <---------HSFC1(2)     ----
------>P                  --------->DAG2--------->ARR11(2) <---------WOX13(1) --------->HSFB2a(2)
-----ANAC58     <---------RVE1(2)       <---------GLK1(1)--------->ATHB12--------->HSFC1(2)    -----
-----ANAC58<----------DOF2<---------TOE1(3)        <----------DOF2  <------ZmHOX2a(1)  --------->ZAT14
ttacctgaagatgacttttgagatggtataaggtaaggcctggaatccccatgactttcatgattgtcttaggagtagcttctgcaacagaacagacaaa  1044300
        --------->AHL20(3)         --------->AHL20(2)
        <---------AHL20(2)      --------->YAB1                            --------->At4g35610
       --------->YAB1--------->DOF5.7(1)               --------->YAB1 --------->ARR11(2)
--------->ZAT18     --------->DOF5.7(1)               <---------ATHB12--------->ARR14(2)
<---------ZAT14    --------->DOF5.7(1) <---------AHL20(2)         --------->YAB5           <--------
--------->ZAT14    ---------->DOF2<---------YAB1      <---------YAB5  <---------ARR14(2) <---------WOX13(1)
----->DAG2<---------AHL20(3)    <---------ICU4       <---------TOE2(3)--------->RVE1(2)--------->ATHB12
----->DOF2<---------AHL25(1)   <---------YAB5------>ZmHOX2a(1)--------->ZAT6  <---------ALFIN1   <--
aagtatactatattaatatcaaaaaagcgtgctagtcattatataatcctcttgctaatgatataacactcactatctgctccaccgagttgattgactg  1044400
                  <---------ARR14(3)               <---------MYB46(3)
       --------->RVE1(2)                   <----------DOF2
      <---------KAN1------>ZmHOX2a(2)     <---------ANAC58                             <------------
     ------->TEIL --------->GLK1(2)       <---------ANAC58    <---------KAN1----------->RAV1(2)
   --------->YAB5 --------->ARR11(3)   <------NtERF2        <------ZmHOX2a(1)       --------->KAN4(2)
  <---------ATHB12<---------AGP1     <---------ANAC46   <---------RVE1(2)   --------->At4g35610
-WRKY18(1) --------->YAB1            <---------ANAC58  --------->ATHB12<---------GLK1(2)        <---
--------DOF2    ----------->ARR10    <---------ANAC58 <---------MYB46(3)--------->RVE1(2)     <-----
cttcaatgaatctctcatgaagatctggagtccattttaggcgtggctttgcatcggttgataggataagtccagaatcacctggactattccctctaag  1044500
          --------->HSFB2a(2)                   <----------DOF2
       <----------DOF2                     --------->HSFB2a(1)                --------->DAG2
-----AGL1 <---------HSFB2a(2)              --------->KAN1  <-----------------AG                    <
---ZmHOX2a(1)                              <---------HSFB2a(1)            <---------ANAC55(2)      -
----TOE2(3)   ----------->GT1            <------ZmHOX2a(1)<---------At4g35610---------->DOF2    ----
gaatggatgcctttcagaagttatatgcattcttgaagatgagaggatgttctttccttggtgctggttttggtaatacataaagtctgtgcaactgtaa  1044600
       <---------WOX13(2)                                                       <---------ANAC58
       --------->WOX13(2)                                         <---------At4g35610
  <---------GATA12                                               <-----------RAV1(1)         <------
  --------->GATA12                                        --------->ARR11(3)    <---------ANAC46
  --------->RVE1(2)                                       <---------ARR11(3)    <---------ANAC58
---------AHL25(1)                    <---------ZAT14  <------ZmHOX2a(1)     <---------ANAC58 -------
-------->AHL20(2)                    --------->ZAT14<---------TOE2(3)       <---------ANAC58 -------
------->GT1 <---------ANAC58      ----------->GT1  --------->MYB52(1)  <----------DOF2 <----------DOF2
gtttaaatctaatttgcttctctcagaagttccaagagagtaaactccaaaaactaaggaagatgtttttgctgcttttgcttacttgtgctttatattt  1044700
           <------MYB83 <---------DAG2
          --------->MYB52(2)                                                     --------->CCA1(2)
          --------->MYB111(1)                                             --------->AHL12(2)
          <---------AtMYB61                                               --------->WOX13(2)
      <---------MYB46(3)<----------DOF2                     --------->WOX13(2)<---------TOE2(3)
      <------MYB46(1)   --------------->AGL15          ----------->GT1    <---------WOX13(2)
      <------MYB83      <---------------AGL15         <----------ID1      <---------AHL12(2)
     <---------AtMYB61 ----------------->AGL2       --------->DOF5.7(1)  <---------ICU4
    <--------P         <-----------------AGL2      --------->DOF5.7(1)   <--------HAHB4
    *TSS  --------->MYB55(2)                       --------->DAG2        --------->YAB5
 <---------TOE1(2)     ----------------->AGL3     --------->DOF5.7(1)   <---------YAB1
 <---------TOE2(2)     <-----------------AGL3    ---------->DOF2        --------->ICU4
<-----------RAV1(2)<----------DOF2               --------->DOF5.7(1)  --------->YAB1      <---------YAB1
---AHL20(3)<---------ANAC58             <---------AtLEC2<------NtERF2 --------->YAB5     --------->RVE1(2)
-->AHL20(3)<---------ANAC46      <------ZmHOX2a(1)--------->DAG2     ----------->GT1    <---------KAN1
-->AHL12(3)<------MYB46(1)<-----------TBP  ----------->GT1  <---------WOX13(2)<---------TOE1(3)
ttctcaggttggtttggtgcaactttgctttatataggaagttgaatggagaaaaagggggcaaattagagaacgataattaaggtatggaatatgaaaa  1044800
                     <---------ANAC55(1)                             --------->AHL20(3)
                     <---------ANAC46                                --------->AHL12(2)
                     <---------ANAC58                                <---------AHL12(2)
                     <---------ANAC58                               <---------ICU4
             <----------DOF2                                       --------->ICU4
            <---------ANAC58     <---------YAB5                    <---------YAB1               ----
            <---------ANAC58     <---------ATHB12                --------->YAB5           --------->YAB5
      <---------ATHB12        ------>ZmHOX2a(1) <---------YAB1<---------At4g35610        --------->ICU4
  ------------>CBF  --------->MYB52(2)       <---------MYB52(1) <---------YAB1           <---------YAB5
actggtccaatcgatgcttttgttacttgtgtcctaatcgtttgaactgttatgtttttgtttgtagatgattattattttatttctatgtattgattcc  1044900
                   ------>MYB46(1)            --------->AHL20(2)        <------NtERF2
                   ------>MYB83               <---------AHL20(2)       <---------SPL7(1)
                 ------->GAMYB                <---------ICU4          <---------ANAC58          <---
                 <---------MYB59            <---------WOX13(2)        <---------ANAC58       <------
         <----------DOF2               ------>ZmHOX2a(2)             <---------LBD16 --------->KAN1
         <---------DAG2     <XXXXXXXXXXXXXXXXXXXXMIR869.1          <-----------RAV1(1)      --------
     --------->REM1(1)    --------->CCA1(2) --------->WOX13(2)--------->KAN1   <---------HSFC1(2)  <
-->ZmHOX2a(1)   --------->ANAC46     <---------GATA12   --------->KAN1<---------ANAC46     ---------
tatggactacaacttttcaacccaactagataccagaattgatccacaattaatgcatcatatgctcattctggcggagggaagtatcttattcccccaa  1045000
   ------>ZmHOX2a(1)                                 <---------CCA1(2)        <---------ANAC58
  <---------MYB59                       --------->ZAT6             --------->KAN1
------DAG2   --------->KAN1  --------->YAB1    <-----------GT1     <---------KAN4(1)
---ALFIN1   <---------YAB1  <---------YAB1  --------->YAB1         --------->KAN4(1)     <---------ANAC46
->LBD16<---------DAG2--------->YAB1    --------->ZAT14            ---------->TaMYB80 --------->At4g35610
-----------GT1    <----------DOF2  <-----------GT1--------->TOE2(3)--------->HSFC1(2)<---------At4g35610
>ANAC46<----------DOF2<---------RVE1(2)<---------ZAT14            <---------KAN4(2)  <-------GAMYB
tttttcctaacttttcttattctttgatattttcatagtcacaacactaataacctctatctctcttggaatattcccaatgcttttcagttgtctggat  1045100
                                                           <---------AHL12(3)               --------
                                                           --------->AHL12(3)               <-------
                                                           <---------AHL20(3)              ---------
                                                           --------->AHL20(3)            <---------TOE2(3)
                                                           --------->AHL20(2)      <---------RVE1(2)
                                                           <---------AHL25(1)      --------->ARR11(3)
                                                       --------->ATHB12        <---------At4g35610
                                                      <---------ATHB12         <---------ZAT2  -----
                                                      <---------YAB5           --------->ZAT2  <----
            <---------YAB5                            <---------YAB1           --------->At4g35610
        ------>ZmHOX2a(1)                             --------->ICU4        <---------YAB5<---------YAB1
       --------->TOE2(3)                     <---------YAB1--------->AHL25(1)<-----------RAV1(2)
 <-----------GT1    <---------YAB5     <-------TEIL  <---------TOE2(3)<----------DOF2   --------->YAB1
tgtttttcttccttattcatggagtcattttcggtctctaggtacattatgagtctaatgatttatatcaagacttttagtcagctgatattgatgatat  1045200
<- Previous    Next ->

AGI:  At3g04030.1   
Description:  myb family transcription factor. similar to MYR1 (MYB-RELATED PROTEIN 1), transcription factor [Arabidopsis thaliana] (TAIR:AT5G18240.2); similar to MYR1 (MYB-RELATED PROTEIN 1) [Arabidopsis thaliana] (TAIR:AT5G18240.3); similar to unnamed protein product [Vitis vinifera] (GB:CAO23500.1); contains InterPro domain Homeodomain-related; (InterPro:IPR012287); contains InterPro domain Homeodomain-like (InterPro:IPR009057); contains InterPro domain Myb, DNA-binding (InterPro:IPR014778); contains InterPro domain Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447)
Range:  from: 1042889    to: 1044705    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version