AthaMap TU-Logo
Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                            <---------AHL12(3)  ----
                                                                            <---------AHL25(1)  ----
                                                       ------->GAMYB        --------->AHL12(3)<-----
----->ZmHOX2a(1)                                      <---------MYB52(2)   <---------ARR11(3) <-----
---ARR11(3)                                         --------->MYB52(1)     --------->AHL25(3)-------
->ZAT2                       <---------bZIP60(2)    <-----------GT1        --------->AHL20(1)-------
>ANAC58           --------->GLK1(2)     --------->GLK1(1)    ---------->DOF2<---------AHL20(2)<-----
>ANAC58  ------>ZmHOX2a(1) <------ZmHOX2a(1)  --------->WOX13(2)           <---------AHL20(1)-------
tcctctcatgtcctgaatgagactcttgaaggacatggctctgaattctaactaataacgaactagaagcagtctctatatatttcttggtaatgcacct  19619900
                                                               ------->GAMYB             <---------AHL12(1)
                                                              --------->MYB46(3)         -------->ATHB1
                                                              <---------MYB52(2)        --------->AHL20(2)
                                                        <------ZmHOX2a(2)               --------->AHL25(2)
                                                       --------->RVE1(2)                --------->AHL20(3)
 ---------->DOF2                                       <---------GATA12                 <---------ATHB51
-------WOX13(2)                                        --------->ARR11(3)               <---------AHL12(1)
------>WOX13(2)                                        <---------ARR11(3)               <---------AHL25(2)
-->MYB46(1)                                            <---------ARR14(3)               <---------AHL20(2)
-->MYB83                              --------->KAN1   --------->ARR14(3)               --------->ICU4
----MYB46(2)                        ----------->RAV1(1)--------->GATA12                 --------->AHL25(1)
----MYB111(1)                      ----------------->AGL2------>ZmHOX2a(2)              --------->AHL12(1)
-->ANAC58                     <---------KAN1     --------->MYB52(1)                     --------->AHL25(3)
-->ANAC46                --------->TOE2(3)      --------->TOE1(2)                 ------>ZmHOX2a(1)
----MYB59    <----------DOF2 <---------WOX13(2)--------->MYB46(3)           --------->ANAC58 <------
-->ANAC58    <---------DAG2  --------->WOX13(2)<---------MYB52(2)           --------->ANAC58--------
aattcaaagttgcagactttttcaagaaccctaataaacccacattcggaacgaacgagatctcaacgaactaaaacacaagctcctccaaattattaaa  19620000
                                       -------->P      --------->ARR11(2)<---------ARR11(2)     ----
                          --------->ARR11(3)           --------->GATA12  <---------ARR14(2)     ----
       --------->ANAC58   <---------GATA12             --------->RVE1(2)<---------GLK1(1) <---------AHL25(3)
       --------->ANAC46   --------->AGP1               <---------GATA12 --------->KAN1    <---------ICU4
<---------AHL12(2)        --------->GATA12             <---------ARR11(3)--------->ARR14(2)     ----
xxxxxxxxxxxxxxxsmallRNA(i)--------->RVE1(2)            <---------ARR14(2)--------->ARR11(2)    <----
-->AHL20(2)              <---------At4g35610           --------->ARR14(2)<---------GATA12 --------->YAB5
-YAB1  --------->ANAC58  --------->At4g35610           --------->ARR11(3)--------->GATA12--------->AHL20(2)
---AHL20(2)      <-----------GT1 --------->ZAT18       --------->AGP1   --------->GLK1(1)--------->AHL25(3)
->AHL20(2)   <---------YAB1<------ZmHOX2a(2)      <-------TEIL     <---------RVE1(2)     <---------KAN1
aaaaaaaaacacgcttcttattacattcagatcaagagtactaacccaataggtacaagatccgattatagatagagatccggatacagagaataaatac  19620100
                      --------->DOF5.7(1)                                      <---------ANAC58
                     --------->DOF5.7(1)                                       <---------ANAC58
                 <---------AHL25(3)                                           --------->ZAT2
         --------->ANAC58  <------NtERF2                                  --------->ALFIN1
         --------->ANAC58 --------->RAP2.6(2)                           <---------ZAT2
  --------->GLK1(1) --------->DOF5.7(1)                                 --------->ZAT2
  <---------GLK1(1) ---------->DOF2                                   <-----------RAV1(2)         --
----->TOE2(3)    --------->AHL20(2)          <-----------GT1       --------->GLK1(2)             <--
----->TOE2(2)    <---------AHL20(2)     --------->ANAC58           <---------ARR14(2)           ----
----->TOE1(2)  <---------WOX13(2)       --------->ANAC58           --------->ARR14(2)  --------->ZAT6
-----ANAC55(2) --------->WOX13(2)   <-----------GT1            --------->YAB1 <---------ZAT2    <---
ctaagaaatcccaagcgaaattaaaaaggccgcatcgattcacaagttatacgagcttcacatcaataagaatccaggtggagcttgggaacagtaccca  19620200
      --------->ALFIN1        <---------ALFIN1
    --------->ARR14(2)       -------->P
    --------->GATA12         ------>MYB83
    <---------ARR14(2)       ------>MYB46(1)                                             *TSS
    <---------GATA12        ----------->RAV1(1)             --------->ANAC46            <---------GATA12
    <---------GLK1(2)      ------->GAMYB                 ------->GAMYB                  <---------ARR11(3)
 <-----------RAV1(2)       --------->AtMYB61           --------->ANAC58                 --------->ARR11(3)
<-----------------AGL1    --------->MYB46(3)           --------->ANAC58       --------->At4g35610
----------------->AGL1    <---------MYB55(2)           --------->ANAC46     <---------WRKY12  <-----
------->PCF2             --------->ANAC58          <-----------GT1        <-----------HVH21   <-----
---------HVH21           --------->ANAC58       <---------DOF5.7(1) ---------->DOF2     <---------RVE1(2)
----->ZAT2             --------->MYB46(3)       <----------DOF2   >>>>>>>>>TBF1  <------ZmHOX2a(1)
------ZAT2   <------NtERF2<---------MYB52(2)<---------KAN1----------->RAV1(1) <---------At4g35610  -
ggtcccagattggggcatcgaaatcgacaaccaacactcgaaagcgaatgccttttacaacccacagaagaagaagcggtcagaggaaatagattttagg  19620300
                                                                    <------------CBF    --------->AHL25(3)
        ----------->GT1                                             <---------WOX13(2)  --------->AHL20(3)
        <---------ANAC46                                            --------->WOX13(2)  <---------AHL20(1)
   <---------LBD16                                                <---------AHL20(2)    --------->AHL20(2)
  <---------ANAC46                                                <---------YAB1 --------->WOX13(1)<
 <---------LBD16                                     <---------ANAC58        --------->WOX13(1) <---
----TOE1(3)                                          <---------ANAC58<---------YAB5     <---------AHL20(2)
----TOE2(3)   <---------KAN1              <---------ATHB12       --------->AHL25(3)<---------YAB5 <-
---------->HVH21   ------->TEIL       ------------>CBF   ---------->ID1   <-----------HVH21<--------
gtttgacgggggagtgaatatgtatgtctgtctctgtgttatccaatcgcttccttccttgtctcatttttaattgttgtcagtcagtcattttattatt  19620400
--------->YAB1          <------MYB46(1)
---------YAB5           <------MYB83
--->AHL12(2)            ----------->GT1                                                       <-----
----AHL12(2)           --------->MYB59                      --------->ARR14(2)               -------
---AHL20(2)         --------->WOX13(2)                      <---------ARR11(2)            --------->WOX13(2)
-->AHL20(3)         <---------WOX13(2)                      <---------ARR14(2)            <---------WOX13(2)
---AHL20(3)      --------------->AGL15                 <---------At5g28300              <---------AHL20(2)
---AHL25(2)      <---------------AGL15                <---------WRKY18(1)               --------->AHL20(2)
-->AHL25(2)     <-----------------AGL1                <-----------GT1                <---------DOF5.7(1)
->AHL12(1)      ----------------->AGL2               --------->WRKY12               <---------DOF5.7(1)
---------YAB1   <-----------------AG <-----------GT1<---------WOX13(1)              <----------DOF2
------AHL20(2)  ----------------->AGL3             --------->WOX13(2)              <---------DAG2
----------GT1   <-----------------AGL3             <---------WOX13(2)         --------->At4g35610  <
-YAB1           <-----------------AGL2           <---------YAB1  <-----------GT1   <---------DOF5.7(1)
ttatcattattttcttcaaactaaatttggtaacaaagttttacatttcattctaattgaccgtattcttaccgatttatcttctgcctttttaattaag  19620500
                               <---------AHL25(1)   --------->MYB52(1)
                       --------->YAB1  --------->At4g35610   ---------->DOF2
          ---------->DOF2      --------->AHL25(3)--------->YAB1
      ---------->DOF2 <---------ATHB51 <---------At4g35610  <---------AHL25(3)
     <---------AHL20(2)--------->AHL20(2)       <---------YAB1        <----------DOF2
 --------->AHL12(3)  --------->WOX13(2)<---------ZAT2       <---------AHL20(2)
 --------->AHL25(1)  <---------WOX13(2)--------->ZAT2       --------->AHL20(2)
 <---------AHL12(3)--------------->AGL15      --------->O2--------->WOX13(2)
----TOE2(3)        <---------------AGL15    ----------->RAV1(1)   <---------ZAT18     <----------DOF2
-->MYB52(1)       ----------------->AGL3  ------>NtERF2   <---------WOX13(2)   ------->TEIL
---------KAN1  <----------DOF2 --------->AHL20(2)--------->YAB5   --------->ZAT18    <---------DOF5.7(1)
ggatatatataaagaaagcttttcaattatagaaataaattaagctgccacatgataacgaaattaaagtgtgctttctatgtatttctctttctcgttg  19620600
                                                                  <---------GLK1(2)        ---------
                                                            --------->YAB5  <---------ARR11(3)
                     <---------HSFC1(1)                    ------->GAMYB  --------->AHL12(1)
                     --------->HSFC1(1)                  --------->WOX13(2)--------->CCA1(1)
                     --------->HSFB2a(2)                 --------->At4g35610--------->GLK1(2)
                     <---------HSFB2a(2)                 <---------At4g35610--------->ARR11(3)
               <---------YAB5                            <---------WOX13(2)--------->RVE1(1)       -
               --------->ICU4                         --------->At5g28300 <---------AHL12(1) <------
 <----------DOF2--------->YAB5                   <---------YAB5 ----------->ARR10         <-------TEIL
ttatcttttgttttggtaatgtttctagaaatgttggaacttcaccgaaataaacatggtaactgactagattctaaaaaatcttgttcaaaattcatca  19620700
         --------->At4g35610                                        <---------DOF5.7(1)  --------->YAB1
<---------AHL20(2)                                                <---------ANAC58 --------->ANAC58
>YAB1    <---------At4g35610                                      <---------ANAC58 --------->ANAC55(2)
-------->AHL20(2)--------->CCA1(2)                            <----------DOF2<----------DOF2
---YAB5 <---------GATA12                 <----------DOF2  <----------DOF2  ------>ZmHOX2a(1)
tataaaatagacatctgaagataagaagacttacaaatagaatactttggtttaatggaaactttctttccgtttttcctctttttacgcaattgtattt  19620800
<- Previous    Next ->

AGI:  At2g47900.1   
Description:  AtTLP3 (TUBBY LIKE PROTEIN 3); phosphoric diester hydrolase/ transcription factor. Identical to Tubby-like F-box protein 3 (TULP3) [Arabidopsis Thaliana] (GB:Q8VY21;GB:O82257); similar to AtTLP10 (TUBBY LIKE PROTEIN 10), phosphoric diester hydrolase/ transcription factor [Arabidopsis thaliana] (TAIR:AT1G25280.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO22416.1); contains InterPro domain Tubby, C-terminal (InterPro:IPR000007); contains InterPro domain Cyclin-like F-box (InterPro:IPR001810)
Range:  from: 19618013    to: 19620290    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version