AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                    <---------ARR11(3)
                                                                    --------->GLK1(2)
                                                                    --------->ARR11(3)
                                                                   --------->RVE1(1)
                                                                 <---------AHL12(2)
                                                               --------->AHL20(2)
                                                           <---------YAB1
                                                          --------->AHL12(2)
                                                        --------->AHL20(1)
                                                        <---------AHL20(1)
                                                        <---------AHL20(3)
                                                        --------->AHL20(2)
                                                        --------->AHL25(1)
                                                        <---------AHL20(2)
                                                        --------->AHL20(3)
                                                        <---------AHL25(3)
                                                        <---------AHL25(1)
                                                        <---------AHL25(2)      --------->WOX13(2)
                                     ------->TEIL  --------->AHL25(3)          --------->ATHB12
<----------DOF2       --------->ARR11(3)         <----------DOF2<---------AHL20(2)
-----DOF2             <---------RVE1(2)--------->TOE2(3)--------->AHL25(2)    <---------YAB1   <----
---ANAC58            <<<<<<<<<RAP2.2<---------CCA1(2)   --------->AHL25(3)    <---------AHL20(2)
---ANAC58 ------>NtERF2--------->CCA1(2)     <---------ZAT18  <---------YAB1 --------->AHL12(2)-----
 
tcactttggaaggcgactcgttttagatatagttcatttgtatcttagtctacttttattttattattaaaaatctcgttttttattggccatttcaaat  15123800
                                                                              --------->ANAC55(2)
                                                                         --------->YAB5
                                                                         <---------ICU4
                                                                         --------->ATHB12
                                                                        --------->ICU4       <------
                                                                        <---------YAB1       -------
                                                                      --------->O2         ---------
                                                                 --------->ANAC58          ---------
                                                         --------->AHL20(2)   <---------ANAC55(2) --
                                         <---------HSFB2a(1)     --------->ANAC58          <--------
 <---------RVE1(2)                       --------->HSFB2a(1)     --------->ANAC46   ----------->GT1
-----AHL12(1)                  <<<<<<<<<<<<<<<<<LFY XXXXXXXXXXXXXXXXXXXX>MIR844  --------->MYB52(1)
---->AHL12(1)          <---------At4g35610        --------->RVE1(2) ----------->RAV1(1)    <--------
 
ttttgatttttgtataccatgtattgagcttatataacaatggaacttgccaaaatcaaattacttacaagccacatgattacataatggataaaaaaat  15123900
                                                                --------->ANAC46
                                                                --------->ANAC58
                                                       <---------ICU4
                                <---------YAB5         --------->YAB1
--------->ANAC46      <---------ETT(2)                 <--------HAHB4
---AHL12(2)         --------->ARR11(2)--------->At4g35610       --------->ANAC58
-->AHL12(2)     --------->DAG2  --------->ICU4        <---------YAB5
>AHL20(2)      ---------->DOF2 --------->WOX13(2)     <---------ATHB12                         <----
>AHL20(3)     <---------MYB52(1)<---------YAB1       ------>MYB83<---------ATHB12             ------
------->ZAT6 --------->LBD16 --------->AHL20(2)      ------>MYB46(1)                      --------->YAB1
-AHL20(3)   <---------ANAC55(2)<---------WOX13(2)   --------->WOX13(1)               --------->AHL20(2)
-AHL20(2)------------------>SPL14--------->YAB1--------->DOF5.7(1)                --------->TOE2(3)
 
aacacaaaaccaagtccgtaaagtatcgacaactaattataagctaagaaaaaaccaatcattttccaagcattgagacttccattcttaaaataagaat  15124000
                      ----------->GT1                                                             <-
                    ---------->DOF2                                               <-----------GT1 --
                  --------->ANAC58                   ------------>CBF    <------------CBF      -----
 ------>NtERF2    --------->ANAC58   --------->DOF5.7(1)                 --------->WOX13(2) <-------
-----KAN1  <---------ANAC58        ---------->DOF2  <-----------GT1      <---------WOX13(2) --------
--->GLK1(2)<---------ANAC58        --------->DOF5.7(1)                ------------>CBF----------->GT1
 
atgaggcccaatgggcttggcaagaaagttaaacaaaaaaaagaagaagacaattttacaattttgtcaagttttcaattgaaataaaccggttaaatcc  15124100
                    --------->ARR14(1)
               --------->YAB1
              <---------ATHB12
          ====================================HOX2a_HOX2a
          <------ZmHOX2a(2)
          ------------>CBF
          <---------KAN1
         --------->RVE1(2)                                                              --------->YAB1
         --------->ARR11(2)                                                             <---------ICU4
       --------->LBD16                                                                 <---------YAB1
     <---------LBD16--------->CCA1(2)                                                  <---------YAB5
   <-----------GT1 <---------ARR11(3)                                                --------->YAB1
 <---------AHL20(2)<---------RVE1(2)                 *TSS                           <---------YAB1
 <---------AHL25(1)--------->ARR11(1)              <-----------GT1                  <---------YAB5
--------->AHL20(2) --------->ARR11(3)              --------->YAB1                 --------->YAB1
--------WOX13(2)   --------->ARR14(2)            --------->RVE1(2)                <---------ICU4
------->WOX13(2)   <---------ARR14(2)           --------->YAB1                   <---------YAB5
------->CBF --------->WOX13(1)                 ---------->DOF2                 --------->YAB1
--GATA12 --------->GATA12              ------>ZmHOX2a(1)                    ------>ZmHOX2a(1)   ----
->GATA12 <---------ARR11(2)     <---------DOF5.7(1)--------->YAB5      --------->KAN1<---------ICU4
 
caatttaaaccggatcaatcaagatatggtaatccccttctccttctccaaaaatcacaactctgttccaagtcttatcctttcatcatcatcatcactt  15124200
                              --------->ANAC55(2)
                         <---------YAB1
                         <---------YAB5
                       <---------ICU4
                       --------->YAB1
                      <---------YAB5                                       <----------DOF2
                   <-------TEIL                                     <---------ARR11(3)
                --------->At4g35610                                 --------->ARR11(3)
               --------->ARR11(3)                         <----------ID1  <---------DOF5.7(1)  <----
   <---------REM1(2)--------->REM1(1)   <---------At4g35610        --------->At4g35610  ------>ZmHOX2a(1)
---->P         <---------ARR11(3)       --------->At4g35610----------->RAV1(1)  ------>ZmHOX2a(1)
 
accttcttcacagagagagagcttcatcatcatatgtaatgtgagatgtctcttgaacaatgcaacaagaagctctctctttcctctcgtcctctctccc  15124300
                                                    <---------ALFIN1
                                                  --------->ANAC58
                                                  --------->LBD16
                                                  --------->ANAC46                         <--------
                                                  --------->ANAC58             --------->YAB1
                                    <----------DOF2--------->LBD16             <---------ICU4
                                  --------->At4g35610                         <---------YAB5 <------
                      <----------DOF2 --------->REM1(1)<----------DOF2 <---------ALFIN1    ---------
             <-----------GT1   ------>NtERF2   <-----------GT1       ------>MYB46(1)      <---------YAB1
   --------->REM1(1) <---------DOF5.7(1)   <---------AHL12(2)        ------>MYB83         <---------YAB5
-----DOF5.7(1)<-----------GT1 --------->DEAR3(1) <---------LBD16 >>>>>>>>>>MYB80 <---------YAB5
 
ttcccttcaccacaattttccctctctttctcgcctccgcttcaacaattttcccgcactttccttcaaaccaaacacttcatcatcatcttcatcattc  15124400
            <-----------GT1
            --------->KAN1
          --------->KAN1
          --------->CCA1(2)
         --------->ARR11(2)
         --------->ARR14(2)
         <---------ARR11(2)
         <-----------ARR10                        --------->MYB52(1)
         <---------ARR14(2)                      <---------ALFIN1           --------->ANAC46
         <---------ARR11(3)                      --------->AtMYB61      <<<<<<<<<GATA-3
 --------->GATA12                                ------->GAMYB          <<<<<<<<<GATA-4
 --------->RVE1(2)             <---------ALFIN1 --------->MYB46(3)      <<<<<<<<<GATA-2
 <---------GATA12              --------->AtMYB61<---------MYB52(2)      <<<<<<<<<GATA-1
 <---------ARR14(2)           --------->ANAC46 -------->P           ------>ZmHOX2a(1)
 --------->ARR11(2)          ----------->RAV1(1)<---------MYB55(2) --------->TOE2(3)
 --------->ARR14(2)         <---------ALFIN1  ------->GAMYB     <---------ARR14(2)
-ICU4<---------LBD16        --------->ANAC46 <---------MYB111(2)--------->ARR14(2)                 -
---YAB1--------->LBD16    ------>ZmHOX2a(1)  <---------MYB55(2) --------->ARR11(2)          --------
>KAN1--------->LBD16     --------->ANAC46    --------->MYB46(3)<---------GLK1(2)          <---------At5g28300
 
ttcaaatccccagatataccctctctctcctccaccacaacaacaacaacaaccaccgaaaccctagaatcctcaatccacgagaaactcatttacctcg  15124500
                                 <---------MYB52(1)
                                <-----------TGA1
                                <-----------HVH21
                          <---------ATHB12                          <---------MYB52(1)         -----
                     --------->TOE1(3)                            --------->DEAR3(1)           -----
      --------->ARR11(2)  <---------YAB5 --------->AtMYB61     --------->ANAC46                -----
      <---------ARR11(2) --------->WOX13(2)        <---------ALFIN1<-------GAMYB             <------
   --------->ANAC58  --------->TOE2(3)   <---------ALFIN1      --------->DEAR3(1)        -----------
   --------->ANAC58 --------->ZAT6    <---------ALFIN1--------->DEAR3(1)               <---------ANAC55(2)
  <---------LBD16------>ZmHOX2a(1)   --------->MYB46(3)--------->ZAT14   <---------YAB5--------->ANAC55(2)
-------->KAN1   <---------MYB59------->GAMYB   ------>ZmHOX2a(1)--------->LBD16   --------->YAB5
->TOE2(3)   <---------GLK1(1) --------->MYB46(3)--------->ANAC46------>NtERF2   <------NtERF2-------
 
attcactcggaatcgatttcctaaccctaatcaaccgtcatccacctctcctctccaccgctctctccgccgttgaatcagtcgtcgattacatgaccac  15124600
                                   <---------O2
                                   ============================================bZIP_DOF
                                   --------->O2
                                   --------->TGA1a
                                --------->ATERF1(1)
                                <------NtERF2
                               <---------ATERF1(1)
                               --------->ABI4(1)
                               ------>NtERF2
                              --------->DEAR3(1)
                              <---------ATERF1(2)
                              --------->RAP2.6(2)
                              --------->ANAC46
                              --------->RAP2.3(3)
                              --------->RAP2.3(2)                               --------->ANAC58
    <---------ATHB12         --------->ATERF1(1)                   <---------DOF5.7(1)      --------
---->ANAC58                  --------->ORA47(2)              ==================bZIP_DOF    <--------
---->ANAC58                  --------->DEAR4(2)              --------->ANAC46   --------->ANAC46
---->ANAC46   <----------DOF2--------->ERF1         <-----------ARR10    XXXXXXXXXXXXXXXXXXXX>MIR403
---ALFIN1     ===============================bZIP_DOF        --------->TGA1a    --------->ANAC58  <-
>HVH21<-----------GT1        --------->RAP2.3(1)    <---------ARR11(3) <-----------GT1   --------->ANAC46
-->AtMYB61    <---------DAG2<---------RAP2.3(1)  --------->HSFB2a(2)<----------DOF2 --------->RVE1(2)
 
tccaccaataaacttcactttacaagactttcgccgcctcgtctcaatgtgtccagagcttctcacttcacctttaacctcacacacaatcccagtcatc  15124700
<- Previous    Next ->

AGI:  At2g35990.1   
Description:  similar to carboxy-lyase [Arabidopsis thaliana] (TAIR:AT5G06300.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN67407.1); contains InterPro domain Conserved hypothetical protein CHP00730 (InterPro:IPR005269)
Range:  from: 15121034    to: 15123855    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
AGI:  At2g36000.1   
Description:  mitochondrial transcription termination factor-related / mTERF-related. similar to mitochondrial transcription termination factor-related / mTERF-related [Arabidopsis thaliana] (TAIR:AT2G34620.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO15834.1); contains InterPro domain Mitochodrial transcription termination factor-related (InterPro:IPR003690)
Range:  from: 15124154    to: 15125706    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version