AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                     --------->WOX13(2)
                                    <---------ICU4
                                ------->GAMYB
               --------->KAN1 ------>MYB83  ------>MYB83
      <---------ATHB12        ------>MYB46(1)<---------ATHB12             <---------ATHB12      <---
     ------>MYB46(1)        --------->MYB46(3)                          --------->WOX13(1)   <------
     ------>MYB83        <-----------GT1    ------>MYB46(1)      ------>ZmHOX2a(1)         <--------
 
cttaaaccaatcgactccatacccgatttcaccaactcacaattaccaatcttccttctcttcttctcctcaaaacaatcaatttcatcaagctccacac  13468900
                     --------->GATA12
                     <---------GATA12
                 ----------->RAV1(2)
                ------>NtERF2
               ------->GAMYB
               <---------ALFIN1
               --------->DEAR3(1)
               --------->DREB2C(2)                                                             -----
              --------->DEAR4(2)                                                              ------
              --------->MYB46(3)                        ------>NtERF2                         ------
              --------->ORA47(2)                   <---------At5g28300                        <-----
              <------NtERF2                        --------->SPL7(1)                          ------
              --------->ATERF1(1)                ----------->HVH21                           <------
             ------>NtERF2                      <---------DOF5.7(1)                        ---------
             <---------ATERF1(1)            ------>NtERF2<------NtERF2                     <--------
            <---------ALFIN1               <---------ZAT18                                 <--------
            --------->DEAR3(1)            <---------RAP2.6(2)                              <--------
     <---------ZAT14 --------->AGP1      <---------At4g35610                               ---------
     <---------REM1(2) ------>ZmHOX2a(2) --------->At4g35610        --------->ANAC46  <---------At4g35610
-------DOF2<---------MYB55(2)         --------->LBD16  --------->DEAR3(1)             --------->At4g35610
---ALFIN1  --------->MYB46(3)        --------->ANAC46  <---------DEAR3(1)          <------ZmHOX2a(1)
-ALFIN1  --------->ANAC46      --------->ZAT6 <------------------SPL14   <---------KAN4(2) ---------
 
tttcagtcttcacagccaccgcctgatctagtaaacactcccgtagcggcctcttacggcgacgatagtagacgcgaacaatctcaggacgctgaatccg  13469000
      <---------YAB5
    --------->YAB1                                                                  <---------HSFB2a(2)
   <---------YAB1                                                                 ----------->RAV1(2)
---->LBD16                                                                       --------->GLK1(2)
--->ANAC58                                                                     <---------HSFB2a(1)
--->ANAC46                                                                     <---------HSFC1(2)
----ANAC55(2)                                                                  --------->HSFB2a(1)
--->ANAC58                <-----------HVH21                                    --------->HSFC1(2)
---LBD16                  <-----------TGA1                                     <---------At4g35610
>ARR14(2)       --------->YAB5                                           --------->At4g35610
-GATA12--------->KAN1    --------->YAB1                                --------->ATHB12
-ARR14(2)      --------->ANAC58                  --------->TOE2(3)     --------->YAB1
-ARR11(2)      --------->ANAC58              <---------MYB52(1)       <---------ATHB12
>ARR11(2)     --------->SPL7(1)   --------->ZAT6 --------->TOE1(3)    <---------YAB5--------->HSFB2a(2)
>GATA12--------->YAB1--------->MYB46(3) <---------ALFIN1            --------->WOX13(1)   <---------DOF5.7(1)
 
caacttataatcatccgaacgacaacaatcgtcactagcactaacaccgctaccttcaatctcgaattgctcaatcatcggaagcttctgggccttaacc  13469100
                                                                                               -----
                                                                                               <----
                                     --------->At4g35610                                       -----
                                     --------->ZAT14                                           <----
                        --------->ANAC46                                      <---------GLK1(2)-----
                        --------->ANAC58                          --------->KAN1 --------->YAB1<----
                        --------->ANAC58                         --------->ARR14(2)            <----
                       ------>MYB83  <---------ZAT14             <---------RVE1(2)       --------->ARR11(2)
                       ------>MYB46(1)                           --------->ARR11(3)      <---------ARR11(2)
                      --------->MYB52(1)                         <---------GLK1(2)       <---------GATA12
                     --------->AtMYB61                           <---------ARR11(3)      <---------ARR14(2)
                    --------->DEAR3(2)                           <---------ARR14(2)      --------->ARR14(2)
                    --------->MYB46(3)                           <---------ARR11(2)      <----------
      <---------At4g35610          --------->ANAC46              --------->ARR11(2)      --------->GLK1(2)
      --------->At4g35610------->GAMYB                         ----------->ARR10<---------YAB5 -----
 
ttcttagacatcagactgtgagaaccaacggcattaacacagcacaatgccgatgaaggaatagagtagatactctcaatagaatcgtagcgaatcggag  13469200
        ------>ZmHOX2a(2)
      <---------RVE1(2)              <---------MYB52(1)
      <---------GATA12              --------->TOE2(3)
      --------->GATA12             <---------ANAC46            <---------LBD16
      <---------ARR11(3)           <---------ANAC58          --------->KAN4(2)
--------->ZAT6                     <---------ANAC58         <---------KAN4(1)
---->HSFB2a(1)             ------>ZmHOX2a(2)                --------->KAN1
-----At4g35610           --------->ARR11(2)                 --------->KAN4(1)
---->HSFC1(2)            <---------ARR14(2)                <---------KAN4(2)
-----ZAT2                <---------ARR11(2)          --------->AtLEC2
---->At4g35610           <---------AGP1         --------->ANAC55(1)                               <-
-----HSFC1(2)            --------->GATA12       --------->ANAC46                            --------
-----HSFB2a(1)           <---------GATA12       --------->bZIP60(2)                        ---------
-ARR10--------->ARR11(3) <---------RVE1(2)      --------->ANAC58                       <---------ANAC46
---->ZAT2                --------->ARR14(2)     --------->ANAC58         ---------->DOF2  ----------
 
cttccactagatcgtggacatcaatttcgatctgggtttcgttagaaaaacacgccatggagattattcggagggagaaagcacagggcttcgtaaagga  13469300
                                                  <---------ANAC58
                                                  <---------ANAC58
                                            --------->AHL20(2)
                                            <---------AHL20(2)
                                            --------->AHL20(1)
                                            <---------AHL25(2)
                                            --------->AHL12(1)
                                            <---------AHL25(3)
                                            <---------AHL25(1)
                                            <---------AHL12(1)       ----------->GT1
                                            --------->AHL25(2)    <------------CBF
                                           <---------AHL25(2)     <---------ARR11(2)
                                           --------->AHL25(3)     <---------ANAC46             -----
  <----------DOF2                          --------->AHL25(2)     <---------GATA12         ---------
 <---------DOF5.7(1)                  --------->LBD16     <---------KAN1                   >>>>>>>>>TBF1
--------ALFIN1                --------->ANAC46<------------CBF<---------LBD16          <------ZmHOX2a(1)
->DOF5.7(1)                 --------->ZAT6 --------->AHL25(1)<---------ANAC58        <---------TOE2(3)
>DAG2                    <----------DOF2   --------->AHL12(3)<---------ANAC58  <---------TOE2(3)
>DOF2  <---------ZAT18------>ZmHOX2a(1)    --------->AHL20(2)<---------ANAC46  <---------TOE1(3)
 
gacacctttgctcactctctctatccttctttcactaaacccccaaaaaaattgctagggaatttcgtggattggagaaattagggtttaggaagaagaa  13469400
                     <------ZmHOX2a(2)
                    --------->GATA12
                    <---------GATA12                                                              --
                    --------->ARR14(2)                           ------>NtERF2                    ==
                    --------->AGP1                               --------->LBD16                 <--
                    <---------GLK1(2)                           <---------ANAC46                 ===
                    --------->ARR11(3)                         <---------LBD16                  ----
                    <---------ARR11(3)                         <------NtERF2                    ----
                    <---------ARR14(2)                      <---------LBD16                     <---
        ----------->GT1                               --------->ANAC55(2)                       <---
        <----------ID1                                <---------ANAC58                          ----
       ----------->GT1                                <---------ANAC58                          <---
      --------->DOF5.7(1)            --------->At4g35610 --------->ARR11(2)                     ----
     --------->DOF5.7(1)------>ZmHOX2a(1)           <-----------GT1    <---------WOX13(2)       <---
     --------->DAG2 --------->ARR11(2)         <----------DOF2------>NtERF2       --------->YAB5----
    --------->DOF5.7(1) <----------DOF2   --------->DOF5.7(1)--------->ANAC46    <---------YAB1 ----
    ---------->DOF2 <---------ARR11(2)   ---------->DOF2 <---------ARR11(2)    --------->YAB5   <---
---->GLK1(2)   --------->MYB52(1)   --------->GLK1(2)<---------TOE2(3) --------->WOX13(2) <---------
--------------->ANAC81------>ZmHOX2a(2)  ----------------------->TaNAC69(2)<---------TOE2(3)   <----
 
tcagagaaaaagggaaaaaaacagatcctttggagggagaagctaaaaggcttttttacgtttcccgccgggtttattaagatgatgacaagtctttcag  13469500
                                                                                 ----------->GT1
                                                                             <---------ARR14(2)
                                                                             <---------ARR11(3)
                                                                             --------->RVE1(2)
                                                                             --------->ARR14(2)
                                                                             --------->ARR11(3)
                                                                          <---------AHL25(1)
                                                                          <---------AHL12(2)
                                                                          <---------AHL25(3)
                                                                          --------->AHL12(3)
                                                                          <---------AHL12(3)
                                                                          <---------AHL20(3)
                                                                          --------->AHL20(3)
                                                                         <---------AHL25(3)
                                                                         <---------AHL25(1)
                                                                         --------->AHL25(3)
                                                                         --------->AHL25(1)
                                                                         --------->AHL20(2)
                                                                         <---------AHL20(2)
                                                                        --------->AHL12(3)
<------------CBF                                                        <---------AHL12(3)
---->ZmHOX2a(2)                                                         --------->AHL25(2)
=====================HOX2a_HOX2a                                        <---------AHL20(3)
----ZmHOX2a(2)                                                          --------->AHL20(2)
=====================HOX2a_HOX2a                                        --------->AHL20(3)
----->GATA12                                                            --------->AHL25(1)
----->AGP1                                                              --------->AHL25(3)
------AGP1                                                             <---------AHL12(2)
------GATA12                  <-------TEIL                           --------->ICU4
----->RVE1(2)                <---------KAN1                         <---------AHL25(2)
------ARR11(2)            --------->LBD16                           --------->AHL12(3)
----->ARR11(2)          <---------LBD16                             <---------AHL20(2)
------ARR14(2)      <---------ARR11(3)            <---------ANAC58  <---------AHL12(3)  --------->YAB1
----->ARR14(2)      --------->ARR11(3) --------->YAB1          ------->TEIL --------->RVE1(1)
----->ARR11(3)     <---------CCA1(2)  <-------TEIL--------->ALFIN1  <---------AHL20(3)<---------WOX13(2)
------ARR11(3)   ----------->TBP   --------->KAN1 <---------ANAC58  --------->AHL20(3)--------->WOX13(2)
-DOF2         ------>ZmHOX2a(1)   <-------TEIL  <---------ANAC46  <---------AHL20(2)>>>>>>>>>GT-1
-----CCA1(2)  --------------------->WRI1 <-----------TBP   ------->TEIL--------->AHL12(2)
 
atctattgctctgtctccttatatatctccgcatacatacattcatatatagtgtgtgtgtgtatgtatataaaaattaatatctggttaataaaaacat  13469600
                           <---------------AGL15
                           --------------->AGL15
                          ----------------->AGL2
                          ----------------->AGL3
                      --------->KAN1
                      <---------AHL12(1)
                      --------->AHL12(1)
                    --------->AHL12(3)
                    <---------AHL25(2)
                    <---------AHL12(3)
                    --------->AHL25(2)
                    <---------AHL12(2)
                    --------->AHL12(2)
                   --------->YAB1
                   <---------AHL25(3)
                  --------->AHL20(2)
                <---------AHL12(2)
               <---------AHL25(3)
               --------->AHL20(2)
              --------->AHL25(3)
              --------->AHL25(1)
              <---------AHL12(3)
              <---------AHL20(2)
              --------->AHL20(2)                                --------->AHL12(3)
              --------->AHL12(3)                                <---------AHL20(1)
              <---------AHL25(1)                                <---------AHL20(3)
              <---------AHL12(1)                                --------->AHL20(3)
              --------->AHL12(1)                                --------->AHL25(2)
          --------->AHL20(3)                       <---------MYB52(1)
          --------->AHL20(1)                       <-------GAMYB<---------AHL25(3)
          <---------AHL20(3)                      --------->LBD16
          --------->AHL25(1)                     --------->LBD16<---------AHL25(2)
          --------->AHL25(3)                    <---------LBD16 <---------AHL25(1)
          --------->AHL25(2)               <---------AHL12(1)   --------->AHL25(1)
          <---------AHL25(1)              <---------AHL25(1)    --------->AHL25(3)
          <---------AHL20(2)              <---------AHL12(2)    --------->AHL20(2)
          --------->AHL20(2)              --------->AHL20(2)    <---------AHL20(2)
          <---------AHL12(3)              --------->AHL25(2)   --------->AHL12(2)
          <---------AHL25(2)     <---------HSFB2a(2)      --------->ANAC55(2)      <---------DOF5.7(1)
          <---------AHL25(3)     --------->HSFB2a(2)      <---------ANAC55(2)     <----------DOF2
       --------->YAB1 <---------ICU4      --------->AHL12(3) ------->TEIL        <---------DOF5.7(1)
 
ataaaactaaaaataaaataaataaaaattccacttgtagaaaaaaaaaatcccggttgtcatgtattttattttcaacaagagtcttttttttttgggc  13469700
                        --------->AHL20(2)             <-----------GT1   <---------ICU4
                     <----------DOF2           <---------YAB5            --------->YAB1
                 <---------GLK1(2)            --------->AHL12(2)        <---------YAB5           ---
         <---------GLK1(2)                <---------At4g35610    <---------ANAC46       <---------KAN1
 
aaaattcaacaagagtctctgattcttttatatagttttgttttcagataattgttgtttaccagtttttgtgtaatcttcactacatggaatttgtttt  13469800
<- Previous    Next ->

AGI:  At2g31650.1   
Description:  ATX1 (ARABIDOPSIS HOMOLOGUE OF TRITHORAX); histone-lysine N-methyltransferase/ phosphatidylinositol-5-phosphate binding. Identical to Histone-lysine N-methyltransferase, H3 lysine-4 specific ATX1 (ATX1) [Arabidopsis Thaliana] (GB:Q9C5X4;GB:Q84WP4;GB:Q9SIP3); similar to trithorax protein, putative / PHD finger family protein / SET domain-containing protein [Arabidopsis thaliana] (TAIR:AT1G05830.2); similar to trithorax protein, putative / PHD finger family protein / SET domain-containing protein [Arabidopsis thaliana] (TAIR:AT1G05830.1); similar to trithorax-like protein, histone-lysine N-methyltransferase [Physcomitrella patens subsp. patens
Range:  from: 13462349    to: 13469258    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version