AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                          <-------GAMYB
   <-----------HVH21                                     --------->MYB55(2)
   <-------PIF5                                        <---------ANAC58
   ------->PIF5                                        <-------GAMYB
  --------->ANAC58                                     <---------ANAC46
  <---------O2                                         <---------ANAC58
  --------->TGA1a                                     <------MYB46(1)
  --------->bZIP60(2)                                 <------MYB83
  --------->ANAC58                                    --------->MYB52(2)
  ====================bZIP_DOF                        --------->MYB55(2)
  <---------TGA1a                                     <---------MYB46(3)
  --------->O2                                   --------->DOF5.7(1)
<---------ALFIN1--------->LBD16                  --------->DAG2
-----NtERF2<----------DOF2              --------->ANAC58 --------->MYB111(2)
------->ATERF1(1)         <---------TOE1(1)      <---------TOE1(3)
-------DEAR3(2) ------>ZmHOX2a(1)       --------->ANAC58 <---------MYB46(3)
-------ATERF1(1)--------->HSFB2a(2) <---------ALFIN1 <---------AtMYB61
------DEAR3(1) <---------LBD16    --------->ANAC58   --------->MYB111(1)
-----ORA47(1) ----------->RAV1(2) --------->ANAC58  <--------P                              <-------
--AtMYB61 <---------DOF5.7(1) <------ZmHOX2a(1)  <---------TOE2(3)                         <--------
-DOF2  ------>ZmHOX2a(1)  <---------TOE2(1)  --------->YAB1                        <---------MYB52(1)
 
cggccacgtcctcgctttcctggaccagtactaggaccagcactcgcatcataaggttggttgttgaattgatcaaatggtcttctgttttgtagtggtg  10538600
                                       --------->WOX13(2)
                                       <---------WOX13(2)
                                  <------NtERF2
                          <---------ANAC58
                          <---------ANAC58
                          <---------ANAC55(1)
                     <-----------RAV1(1)<---------WOX13(1)
                     <---------REM1(1)--------->ATHB12
                <---------At4g35610  <---------YAB5
                --------->At4g35610  <---------YAB1
            --------->ALFIN1 <---------DEAR3(1)             --------->HSFB2a(2)            <--------
            <---------DEAR3(1)  <---------ANAC58        <---------ANAC58              --------->DREB2C(2)
--------->YAB5 --------->ALFIN1 <---------ANAC58        <---------ANAC58           <------ZmHOX2a(1)
--MYB46(3) <------ZmHOX2a(1)--------->ALFIN1           <---------HSFC1(2)      <---------TOE1(1)  --
-ZAT6<---------ANAC55(2)  <---------ANAC46             --------->HSFC1(2)      <---------TOE2(1)<---
 
agaccattacatgaggaggtgctgatgttgcgtgggcgtcttcattgacttcatgagatgcttctcggtctattggactagtactaggaccggcatctcg  10538700
                                                   <-------TEIL
                                                 <------NtERF2
                                                <---------DEAR3(2)
                                                <---------ORA47(2)
                                                <---------MYB46(3)
                                               <---------ANAC58
                                               <---------ANAC46
                                               <---------DREB2C(2)
                                               <---------DEAR3(1)        <---------ANAC58
                                               <---------ANAC58          <---------ANAC58       ----
                                              <---------ABI4(1)          <---------ANAC46       <---
                                          --------->MYB52(2)             <---------ANAC55(1)   -----
                                          <-----------RAV1(1)       <---------REM1(1)         <-----
  --------->DOF5.7(1)                     --------->ALFIN1         <---------RVE1(2)  --------->TOE2(3)
-KAN1    ------>ZmHOX2a(1)               <---------AtMYB61         <---------TOE2(3)  --------->WOX13(2)
------->YAB1                        --------->DOF5.7(1)   <------ZmHOX2a(1)           <---------WOX13(2)
--------HVH21 --------->YAB5      ---------->DOF2--------->At5g28300<-----------RAV1(1)     ------->GAMYB
 
gtcataagagtcctcaatgttgaagttatctaatagccaaagggtttgtggcggtgcatgaggaggtattgatgttgcgtgggcttcttcattaacagca  10538800
                                                                                                  <-
                                                                                                ----
                                                                                               <----
                                                                                               <----
                                                                                               <----
   <----------DOF2                                                                            <-----
  <---------DOF5.7(1)                                                                         <-----
  ------>ZmHOX2a(2)                                                                           <-----
  ===================================HOX2a_HOX2a                                              <-----
<---------ARR11(3)                                                                            <-----
--------->ARR11(3)                    <---------KAN1                                         <------
--------->GATA12                    <---------GLK1(2)                                    --------->ALFIN1
<---------RVE1(2)                 --------->ANAC58                                       --------->MYB52(2)
----->At4g35610           <---------TOE2(1)  --------->YAB1                              <----------
------At4g35610           <---------TOE1(1)<-----------HVH21 --------->YAB5             <---------AtMYB61
---->GLK1(2)--------->ZAT14       --------->ANAC58      ------>ZmHOX2a(1)          --------->DOF5.7(1)
----GLK1(2) <---------ZAT14   <------ZmHOX2a(1)  --------->DOF5.7(1)             ---------->DOF2<---
 
tctgatctttctctgtggactggaccagtactaggaccagcatctcggtcataagagtcctcaatgttgaagttatctaatagccaaagggtttgtggcg  10538900
      <---------------AtSPL3
     <------ZmHOX2a(1)
------TEIL
----->At5g28300
-----ORA47(2)
-----MYB46(3)                                                                         --------->RVE1(2)
-----DEAR3(2)                                                                        --------->GLK1(1)
----ANAC58          <---------ANAC58           <---------GLK1(2)                     <---------KAN1
----ANAC46          <---------ANAC46           --------->ARR11(3)                    --------->At4g35610
----ANAC58          <---------ANAC55(1)        <---------RVE1(2)                   <---------GLK1(2)
----DEAR3(1)        <---------ANAC58           --------->GATA12          <---------TOE1(1)
----DREB2C(2)  <-----------RAV1(1)     ------->GAMYB                     <---------TOE2(1)  --------
---ABI4(1)     <---------REM1(1) <---------WOX13(2)        <---------ZAT14       --------->ANAC58
-RAV1(1)      <---------TOE2(3)  --------->TOE2(3)         --------->ZAT14       --------->ANAC58
---NtERF2   --------->ICU4       --------->WOX13(2)        <---------ZAT18   <------ZmHOX2a(1)
 
gtgcatgaggaggtactgatgttgcgtgggcttcttcattaacagcatcagatttttctcggtggactaaaccagtactaggaccagcatctccatcatc  10539000
               <------MYB83
               <------MYB46(1)
              --------->MYB111(2)
              --------->ALFIN1                                                       --------->YAB1
              <---------AtMYB61              <------------CBF   <---------REM1(1)   <---------ATHB12
             <--------P               ----------->GT1    <---------ARR11(3)       --------->WOX13(1)
            <-------GAMYB           --------->ZAT14      --------->ARR11(3)     ------------>CBF
   --------->TOE2(3)         --------->YAB5<---------YAB1<---------GATA12   --------->WRKY38(1)
->YAB1--------->YAB1--------->ALFIN1<---------ZAT14      --------->GATA12<---------ANAC46        ---
 
aaatagcattaatagggttggaggtgttgagaccattactgtagttaatattgtctactaaatcttgttgtaactggtgttgactcaatcagaatagact  10539100
                                                       <---------AHL20(2)
                                                       <---------AHL25(1)
                                                       --------->AHL25(1)
                                                       --------->AHL20(2)
                                                     --------->WOX13(2)
                                                    <--------HAHB4
                                                    --------->ATHB51
                                                    <---------ICU4
                                                   <---------YAB1                               <---
                            ---------->DOF2        --------->ICU4                             <-----
                         ----------->TBP         --------->YAB5                               <-----
                         <---------YAB1          --------->YAB1                               <-----
                       --------->YAB1            <---------ICU4                              <------
                    <--------HAHB4              <---------YAB5                            <---------AHL12(2)
                    --------->YAB5            --------->WOX13(1)                          <---------WOX13(2)
                    <---------ICU4          ------------>CBF           <---------AHL20(2) --------->AHL12(2)
                    --------->YAB1        --------->GLK1(1)        <---------RVE1(1)      --------->WOX13(2)
                   <---------YAB1        <---------ARR11(3)        <---------CCA1(1)     <---------ICU4
            --------->GLK1(1)            --------->ARR11(3)       <---------RVE1(2)     --------->ICU4
            <---------GLK1(1)    ---------->DOF2<---------ATHB12  --------->ARR11(3)    <---------YAB1
       ---------->DOF2<---------YAB1    <---------At4g35610       <---------ARR14(2)  --------->YAB1
<---------MYB46(3) <---------ATHB12     --------->At4g35610       <---------ARR11(3) <---------YAB1
------>MYB52(1)  ------>ZmHOX2a(1)--------->DOF5.7(1)<---------WOX13(2)--------->AHL20(2)--------->YAB5
 
tatcggttgcaaaagaaatcctatcattataaaaagaaaagtcagatatcaatcataattaaacaagaagatatttaaaaactattttgtgataattaac  10539200
                                                                                                   -
                                                            <---------AHL20(2)                     <
                                                          <---------WOX13(2)                       -
                                                      ------>ZmHOX2a(2)                            <
                                                     <------ZmHOX2a(2)                             -
                                                    --------->ARR11(3)                             <
                                                    --------->AGP1                                 -
                                                    <---------AGP1                                 -
                                                    --------->GATA12                               <
                                                    <---------GATA12                               -
                                                    --------->RVE1(2)                              <
                               <------------CBF     <---------ARR11(3)                            --
                             <---------AHL25(1)     --------->ARR11(2)                            <-
                             <---------AHL20(3)     <---------ARR11(2)                           <--
                             --------->AHL20(3)     <---------ARR14(2)                          <---
                             <---------AHL20(2)     --------->ARR14(2)                          ----
                         --------->YAB1     --------->AHL20(1)                                 <----
                        <---------YAB1      <---------AHL20(2)                                 -----
                       <---------AHL25(2)   <---------AHL20(1)                                 <----
                       --------->AHL20(3)   --------->AHL20(3)                                 -----
                       --------->AHL25(2)   <---------AHL20(3)                                 -----
                       <---------AHL20(3)   --------->AHL20(2)                                 <----
                     --------->AHL20(2)     --------->AHL25(3)             --------->WRKY18(1) -----
                     <---------YAB1         --------->AHL25(1)        --------->TOE2(3)      -------
                     --------->AHL20(3)     --------->ARR11(3)       --------->YAB5    --------->ANAC58
                     --------->AHL25(1)     <---------ARR11(3)       --------->KAN1    --------->ANAC58
  ------------>CBF   <---------AHL20(2)     <---------AHL12(1)<---------ANAC46 ------------>CBF<----
---------CBF         --------->AHL25(3)     --------->AHL25(2)<---------ANAC58--------->ANAC58------
----TOE2(3)          <---------AHL20(3)     <---------AHL25(1)<---------ANAC55(2)      --------->ANAC46
----YAB1          <---------ARR11(3)        <---------AHL25(2)<---------ANAC58--------->ANAC58<-----
----YAB5       ----------->RAV1(1)     ------------>CBF   --------->WOX13(2) --------->WOX13(1)-----
-----GT1    --------->ANAC46--------->AHL20(2)     <---------CCA1(2)<---------YAB5--------->WOX13(2)
 
attgtgacaatattcaaacaacatattattataaaattgcataacaatatattcagatctaaattacttgaaacattagtcaagcaatttacgcaaaaat  10539300
            <-----------TBP
            --------->AHL12(3)
            --------->AHL20(2)
          <-----------TBP
          --------->AHL20(2)
 --------->AHL12(2)
 <---------AHL12(2)
--------->AHL20(2)
<---------AHL25(3)
-------->AHL25(3)
---------AHL25(1)
-------->AHL25(1)
---------AHL12(3)
-------->AHL20(3)
---------AHL20(3)   <---------AHL12(3)
-------->AHL12(1)   --------->AHL12(3)
-------->AHL12(3)   <---------AHL20(2)
---------AHL12(1)   <-----------TBP
-------->AHL20(2)   --------->AHL20(2)
---------AHL20(2) --------->AHL12(3)
------->AHL12(2)  <---------AHL20(2)
--------AHL12(2)  <-----------TBP
-------AHL12(2)   <---------AHL12(3)
------AHL25(3)    --------->AHL20(2)
----->AHL20(2)  <---------AHL12(3)
-----AHL12(3)   --------->AHL20(2)                                                               ---
---->AHL12(3)   --------->AHL12(3)                                                           <------
-----AHL20(2)   <-----------TBP                                                              <------
---->AHL20(2)   <---------AHL20(2)                                                           -------
---->AHL25(1) <-----------TBP                 --------->ANAC58                              <-------
-----AHL25(1) --------->AHL20(2)              --------->ANAC58       --------->ARR11(3)     <-------
---->AHL12(1) <---------AHL20(2)       --------->TOE2(3)    --------->ANAC58              --------->YAB1
-->YAB1   --------->AHL12(3)           --------->TOE1(3)    --------->ANAC58            --------->ANAC58
-----AHL12(1) <---------AHL12(3)    <-----------GT1        --------->DAG2               --------->ANAC58
--->AHL12(2)<---------AHL20(2)  --------->AHL20(2)        ---------->DOF2            <---------ATHB12
----AHL12(2)<---------AHL12(3)  <-----------TBP        <---------ANAC55(2)     --------->MYB52(1)---
---->AHL25(3) --------->AHL12(3)--------->AHL12(3)    <-------TEIL--------->AHL20(2) <---------KAN1
 
aaataaataacatatatatatatatatatacacatatatatacctcaacacgaacgatacataaagcaataacatattgaaacaacgaatcaagcatata  10539400
                            <------ZmHOX2a(2)
                            =============HOX2a_HOX2a
                           --------->ARR11(2)
                           <---------GATA12
                           <---------ARR14(2)
                           --------->GATA12                       <---------GLK1(2)
                           --------->ARR14(2)                     <---------ARR14(2)
------>TOE1(3)             <---------ARR11(2)                    <------ZmHOX2a(1) <---------ZAT6 <-
---ARR11(2)          --------->DOF5.7(1)                     ---------->DOF2       <---------ANAC46
---ARR14(2)     ---------->DOF2                          ---------->DOF2  --------->ARR11(3)     ---
-->ARR14(2)    <---------ATHB12                        --------->ANAC58   <---------RVE1(2)     ----
--KAN1        <---------WOX13(2)        ----------->GT1--------->ANAC58   <---------ARR11(3)  <-----
---TaMYB80 --------->AHL20(2)------>ZmHOX2a(2)     --------->ANAC58      --------->YAB1 <---------TOE1(3)
------>TOE2(3)--------->WOX13(2)  <------ZmHOX2a(1)--------->ANAC58     <---------YAB1  <---------TOE2(3)
 
ccttaaaactgaaattcaataaagaagacggatcgaaggagaagagaaaattggaagcaagaaagaaaggattctatgatattgtagagtgaaggttatc  10539500
<- Previous    Next ->

AGI:  At2g24740.1   
Description:  SDG21 (SET DOMAIN GROUP 21). Identical to Histone-lysine N-methyltransferase, H3 lysine-9 specific SUVH8 (SUVH8) [Arabidopsis Thaliana] (GB:Q9C5P0;GB:Q9TP24); similar to SUVH7 (SU(VAR)3-9 HOMOLOG 7), histone-lysine N-methyltransferase/ zinc ion binding [Arabidopsis thaliana] (TAIR:AT1G17770.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO46198.1); contains InterPro domain Pre-SET zinc-binding region; (InterPro:IPR007728); contains InterPro domain SRA-YDG (InterPro:IPR003105); contains InterPro domain Post-SET zinc-binding region; (InterPro:IPR003616); contains InterPro domain HMG-I and HMG-Y, DNA-binding (InterPro:IPR000637);
Range:  from: 10536769    to: 10539036    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version