AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                          <-------TEIL
                                                                                         --------->ARR14(1)
                                                                                        --------->ARR11(1)
                                                                                        --------->ARR14(2)
                                       <---------ANAC58                                 <---------GATA12
                                       <---------ANAC58                                 <---------ARR14(2)
                               <---------ZAT2                                           <---------GLK1(2)
                               --------->ZAT2                                           --------->ARR11(2)
                              --------->ANAC58                                          --------->GATA12
                              --------->ANAC46                                          <---------ARR11(2)
                              --------->ANAC58                                          <---------RVE1(2)
                  ---------->DOF2  --------->KAN1                         --------->HSFB2a(2)
                  <---------AHL20(2)  <-------TEIL          <---------RVE1(2)          --------->KAN1
                 --------->AHL20(2)<---------HSFB2a(1)  <---------At4g35610    --------->ZAT6
               <---------WOX13(2)  --------->HSFB2a(1)  <-------GAMYB     <---------HSFB2a(2)<------
 
aaatagggtttaagagcccattaaatcagagcccagcaacgttcgtgtttgttttgttcagttgatatagaaccagtctcgaactctagtagattcgttg  9962300
                                                                   ================================bZIP_DOF
                                                                   <---------TGA1a
                                                                   --------->TGA1a
                                                                   <---------O2
                                                                   --------->ANAC46
                                                                   --------->ANAC58
               <---------LBD16     --------->GATA12                --------->bZIP60(2)
             --------->GLK1(2)     <---------GATA12                --------->ANAC58     <---------DOF5.7(1)
           --------->KAN1      --------->LBD16                   <---------ALFIN1       <----------DOF2
          <---------RVE1(2)   --------->DEAR3(1)               ------>NtERF2            <---------DAG2
          <---------ARR11(3) --------->ATERF1(1)              >>>>>>>>>AtERF-4        ------>MYB83
      <---------O2           <------NtERF2                    >>>>>>>>>AtERF-3        ------>MYB46(1)
      <---------ANAC46      <---------ATERF1(1)             <---------At4g35610     --------->MYB46(3)
      <---------ANAC55(2)   ------>NtERF2----------->GT1    --------->At4g35610     <---------ALFIN1
      --------->O2         <---------DEAR3(1)               <---------ZAT2          --------->AtMYB61
      --------->ANAC55(2)  --------->DEAR3(1)               --------->ZAT2          <---------MYB111(2)
     <-------TEIL         --------->ATERF1(1)          <---------GATA12             <---------MYB111(1)
  --------->ZAT2         <-----------HVH21             --------->GATA12      <-----------GT1       <
  <---------ZAT2 --------->LBD16<------NtERF2    <---------WOX13(2)--------->O2    --------->MYB46(3)
---MYB52(1)<----------TaMYB80<---------LBD16  <---------RVE1(2)<-----------HVH21 --------->ANAC46  -
 
tctcgagctacgtgatattccggtaaaccgtcgccggagatgtacagtagataattcaaatcgagctgccacgtcgctattttcccaccaactttttttt  9962400
                                                                                   <---------GATA12
                                                                                   --------->GATA12
                                                                           <---------AHL12(3)
                                                                           --------->AHL25(1)
                                                                           <---------AHL25(1)
                                                                           <---------AHL25(2)
                                                                           --------->AHL25(2)
                                                                           <---------AHL20(2)
                                                                           <---------AHL25(3)
                                                                           --------->AHL12(3)
                                                                          <---------AHL12(3)
                ----------------------->TaNAC69(2)                        <---------AHL20(2)
             --------->DAG2                                               --------->AHL20(2)
            ---------->DOF2                                               <---------AHL12(1)
    <---------AHL25(3)                                                    --------->AHL12(1)
    <--------ATHB1                                                        --------->AHL12(3)
    --------->ATHB12                                                      <---------AHL25(3)
    <---------ICU4                                                        --------->AHL25(1)       <
    -------->HAHB4                                                        <---------AHL25(2)       -
    --------->ATHB51                                                      --------->AHL25(3)      <-
   --------->AHL12(1)                                                     --------->AHL25(2)      --
   <---------AHL12(1)                                                    --------->AHL12(2)       --
   --------->AHL25(3)                                                    <---------AHL12(1)       --
   <---------AHL20(2)              ------------>CBF                      --------->AHL25(3)       --
   --------->AHL20(2)             ----------------->AGL1                 --------->AHL12(1)       --
   <---------ATHB51          --------->ANAC58                            <---------AHL25(2)       <-
   --------->AHL25(1)        --------->ANAC58                            <---------AHL12(3)       <-
   <---------AHL25(1)        --------->ANAC46                       --------->ANAC58              <-
 --------->AHL12(2)        <-----------GT1                   ----------->GT1       <---------RVE1(2)
 --------->WOX13(2)      <-----------GT1                   ---------->DOF2<---------AHL25(1)      --
---------AHL20(2)     <---------WOX13(2)               <----------DOF2   --------->AHL12(3)   ------
-------->AHL20(2)     --------->WOX13(2)      ------------>CBF      --------->ANAC58        --------
 
ttttaaataattggaaaaagtttctaatttacacgcttcccaattcgtaaacaatgttctttaaaagtaaaacgaaattttttttggatttgaagataaa  9962500
                                                                                                <---
                                                                                               <----
                                                                                               -----
                                                                                               -----
                                                                                               <----
                                                                                               <----
                                                                                               -----
                                                                                               <----
                                          <-----------GT1                                      <----
                                  <---------TOE2(3)                                            <----
       <---------AHL25(3)    <---------AHL25(3)                                                -----
      --------->AHL20(2)    --------->AHL20(3)                                                 -----
------ZmHOX2a(2)            --------->AHL12(1)                                                 <----
-------->CCA1(2)            <---------AHL20(3)                                                <-----
--------ARR11(2)            <---------AHL12(1)        --------->KAN1                          <-----
------->AGP1               <---------AHL12(2)      >>>>>>>>>E2Fd                             -------
------->ARR11(3)           --------->AHL12(2)     ------>NtERF2                          ------>NtERF2
------->ARR11(2)          <---------AHL12(2)      --------->LBD16                      ----------->HVH21
------->RVE1(2)           --------->AHL12(3)     --------->ANAC58                     <---------HSFB2a(2)
------->GATA12            --------->AHL12(2)     --------->ANAC58                 --------->GLK1(1)
--------GATA12            <---------AHL12(3)     --------->ANAC46                <---------GATA12
--------ARR11(3)         <---------AHL12(1)     <---------MYB55(2)               --------->GATA12---
--------ARR14(2)         --------->AHL12(1)     --------->MYB46(3)     ----------->RAV1(1) <--------
------->ARR14(2)         --------->AHL25(3)  ------->GAMYB          ================================
---->DOF2                --------->AHL20(2) --------->MYB46(3)      ================================
->CCA1(2)       <------------CBF  <---------TOE1(3)>>>>>>>>>E2Fc    ------>ZmHOX2a(1) --------->HSFB2a(2)
 
agatccaaaataaaaacaaaattgaagataaatttttagggtttataacgacccgccaaattccttctctcctccaacatttcagatttcgcgacccgga  9962600
          --------->ANAC58
       --------->PCF2
       --------->ARR11(2)
       --------->ARR14(2)
       <---------TCP15(1)
       <---------TCP20                                                                          ----
       <---------ARR11(2)                                                                     <-----
     --------->LBD16                                                                          ------
    --------->ANAC46                                                                         -------
   <---------LBD16                                                                           -------
---ZmHOX2a(2)                                                                               ------>NtERF2
-----ARR14(2)                                            <---------HSFB2a(1)               <--------
---->ARR14(2)                                            <---------HSFC1(2)               --------->ATERF1(1)
---->ARR11(2)                                            --------->HSFB2a(1)              --------->MYB46(3)
-------ARR10                             <<<<<<<<<<<<<<<<<LFY                            <---------ATERF1(1)
-----ARR11(1)                         <---------ANAC58   --------->HSFC1(2)              ------>NtERF2
---->ARR11(3)                  ------>ZmHOX2a(2)        <-----------ARR10               <---------ARR11(2)
-----ARR11(3)                 <------ZmHOX2a(2)     <-----------RAV1(2)                 --------->PCF2
-----ARR11(2)                --------->ARR14(2)    <------NtERF2                     ------>ZmHOX2a(2)
-----GATA12                  --------->GATA12     <-----------HVH21                 <------ZmHOX2a(2)
---->RVE1(2)                 --------->ARR11(2)   <-----------TGA1                 --------->ARR14(2)
---->GATA12             <---------ARR14(2)       --------->TGA2(1)                 <---------ARR14(2)
-----AGP1 --------->ANAC58   <---------RVE1(2)   --------->bZIP60(1)               --------->GATA12
----ARR14(1)            <---------ARR11(2)       <---------ANAC46                  <---------GATA12
----CCA1(2)--------->LBD16   <---------GATA12    <---------bZIP60(1)          ----------->RAV1(1)
-->LBD16 <---------LBD16--------->ARR14(2)       <---------ANAC58             ------>NtERF2---------
--->ZmHOX2a(2)          --------->ARR11(2)------------>CBF      <---------DOF5.7(1)<---------ARR11(2)
-LBD16 <---------ARR14(2)    <---------ARR14(2)  <---------ANAC58    <<<<<<<<<TBF1 --------->RVE1(2)
====HOX2a_HOX2a    <-----------GT1    <---------ANAC58<---------At4g35610  ------>NtERF2--------->ARR11(2)
===HOX2a_HOX2a<---------KAN1 <---------ARR11(2) <-----------------------TaNAC69(2) --------->ARR11(2)
 
tcttaacccggacccgcatttgtttcggttccgatctggtttcttgacaatggcgtcagaagcttcgccttcttcttcggccaccagatcggagccaccc  9962700
                     <---------DOF5.7(1)
                 <---------YAB5               --------->DOF5.7(1)
                 <---------ATHB12          <---------HSFB2a(2)
               --------->WOX13(1)          --------->HSFB2a(2)
           <---------ANAC58                --------------->AGL15
           <---------ANAC46                <---------------AGL15
        <---------MYB52(1)                ----------------->AGL2
     <---------LBD16<---------MYB52(1)    <-----------------AGL2
------>DOF2<---------ANAC58               ----------------->AGL3
----MYB55(2)  --------->KAN1              <-----------------AGL3                              <-----
--->MYB46(3)<-----------HVH21             ----------------->AG<----------DOF2                <------
-->ANAC58 <-------TEIL                 <----------DOF2     <-----------GT1              <---------RVE1(2)
-->ANAC58 --------->SPL7(1)         <-----------GT1    <----------DOF2                 --------->ATHB12
-ALFIN1--------->LBD16 --------->AHL12(2) <-----------------AGL1                    <----------DOF2
>DEAR3(1)--------->ALFIN1       <-----------GT1        <---------DAG2     <---------TOE2(3)  <------
 
aaagactctccggtgcgtcaatcgttttttttttttttcttactttctaaaaatggaacttttttctttgtgctattgaggcattgactttgatttgctt  9962800
                                                                        <---------ANAC58
                                                                        <---------ANAC58
                                                              ------>ZmHOX2a(2)
                                                             <------ZmHOX2a(2)
                                                            --------->ARR11(3)
      <---------ZAT14       <----------DOF2                 --------->GATA12
      --------->ZAT14      <---------ANAC58                 <---------ARR11(3)
   <---------ANAC46        <---------ANAC46                 <---------RVE1(2)        --------->CCA1(2)
-----DOF2                  <---------ANAC58                 --------->AGP1          <---------RVE1(2)
---ANAC58     --------->ANAC58               --------->KAN1 <---------AGP1          <---------ARR11(3)
---ANAC58     --------->ANAC58      <---------At4g35610     <---------GATA12        --------->ARR11(3)
 
tagtttgagtgaagagaacgaaactcgatggcttgtttgagcttctctatatgctcgtttttagatctagagattgctggattgtgagatatgaagttgt  9962900
                                                                                           <------ZmHOX2a(1)
                                                                                        --------->ATERF1(1)
                                                                --------->ARR14(2)      <------NtERF2
             <---------ARR11(2)                                 <---------ARR11(2)    --------->ALFIN1
            <------ZmHOX2a(1)        XXXXXXXXXXXXXXXXXXXX>MIR413--------->ARR11(2)    <---------DEAR3(1)
     --------->MYB52(2)          <---------RVE1(2)              <---------ARR14(2)<-----------RAV1(2)
    <-------TEIL       <---------At4g35610                 ---------->DOF2      <-----------HVH21
 <---------ANAC58      --------->At4g35610               --------->REM1(2)  <---------TOE2(3)
 <---------ANAC58  <---------DOF5.7(1)             --------->ZAT6  --------->TOE2(3) <---------LBD16
 
ttttgggttcgtttaggaaccatttttgctgcaattgatagtttctctcattgaacactgtgtaaaggaacctcattttgatgtttcaggcggaggagag  9963000
                                                             <------MYB46(1)
                                                             <------MYB83
                                                        ----------->HVH21
                                                      <---------At4g35610
                                                      --------->ZAT2
                   --------->YAB1                     --------->At4g35610      <--------P
          <---------TOE2(3)                     <---------ANAC58            <---------TOE2(3)
    <---------GLK1(2)                          <---------HSFC1(2)           --------->DOF5.7(1)
   <---------At4g35610                         --------->HSFC1(2)         ---------->DOF2
   <---------ZAT2--------->RVE1(2)    ---------->DOF2 <---------ZAT2     <---------ATHB12
<-------TEIL<------ZmHOX2a(1)  <---------GLK1(2)<---------ANAC58    --------->RVE1(2)<---------YAB1-
 
aggtccagcttctaaggaagtatcagaagtaatagaatcgctaaagaagaagcttgcagctgataggtgtatatcaataaaggttgctatttttgtttag  9963100
                                  <---------MYB46(3)
                                 <---------WOX13(1)
                              <---------YAB1
                           <---------ARR14(2)
                           ------->TEIL
                           --------->ARR14(2)                        <---------WOX13(1)
                           --------->GLK1(2)                       <------ZmHOX2a(1)
                           <---------GATA12                    ---------->DOF2          <---------KAN1
                           --------->GATA12               ----------------->AGL3       --------->GLK1(2)
-------->AHL12(2)    <---------ARR11(2)                 <-----------GT1            --------->YAB1
 
ttttttttttgtatgttttatgtgtttctgaatctgattgttagaaattgatgtgtttgtaaccagaaaaggattgatgaaaacaagaagaatttgtttg  9963200
<- Previous    Next ->

AGI:  At2g23380.1   
Description:  CLF (CURLY LEAF); transcription factor. Identical to Polycomb group protein CURLY LEAF (CLF) [Arabidopsis Thaliana] (GB:P93831;GB:O80455); similar to EZA1 (SWINGER), transcription factor [Arabidopsis thaliana] (TAIR:AT4G02020.1); similar to PHCLF2 [Petunia x hybrida] (GB:BAC84951.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO71880.1); similar to PHCLF1 [Petunia x hybrida] (GB:BAC84950.1); contains InterPro domain SET; (InterPro:IPR001214)
Range:  from: 9962650    to: 9967439    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version