AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                          --------->AHL12(1)
                                          <---------AHL12(1)
                                          --------->KAN1
                                         --------->AHL12(1)
                                         <---------AHL12(1)
                                         <---------AHL12(2)
                                         <---------AHL20(3)
                                         --------->AHL20(1)
                                         <---------AHL20(1)
                                         --------->AHL25(2)
                                         --------->ARR11(3)                 ----------->RAV1(1)
                                         <---------AHL25(2)                --------->AtMYB61
                                         <---------ARR11(3)             --------->ANAC46
                                         --------->AHL20(3)           <-----------GT1
                                        <---------AHL12(3)         <---------AHL12(2)
                                        --------->AHL12(2)         <---------YAB1
                                        <---------AHL12(2)        <---------AHL20(3)
                                        --------->AHL12(3)        --------->AHL25(2)
                             ---------->DOF2                      <---------AHL25(2)            <---
                      <---------YAB1    --------->AHL25(2)        --------->AHL20(2)  --------->DAG2
                   --------->AHL25(3)   <---------AHL25(2)        --------->AHL20(3) ---------->DOF2
----------GT1    <----------DOF2      --------->AHL20(2)    --------->TOE2(3) --------->AtMYB61 ----
 
ttaacttggtttttctcttacttttattttagcaaagttcaaaaaatattcgaaaattgtcaacttcaatattatacaccaccaaaaaaaaagttttcta  2342100
                                                                                                  --
                                                                                             <------MYB46(1)
                                            <-----------------AGL1                           <------MYB83
                                       --------->AHL20(2)                           <---------AHL25(1)
                       <---------DOF5.7(1) --------->YAB1                           <---------AHL20(3)
                      <----------DOF2  <---------AHL20(2)                           <---------AHL25(3)
            --------->RVE1(2)      --------->AHL20(2)                               --------->AHL20(2)
            --------->ARR11(3)     <---------AHL20(2)                         --------->TOE2(3)  <--
            <---------ARR11(3)  <----------DOF2                               --------->YAB1--------
    <---------MYB52(1)<---------DAG2 --------->WOX13(2)                    <-----------GT1  --------
<---------ZAT2        <---------DOF5.7(1)  <-----------GT1              --------->ANAC55(2) --------
<---------At4g35610  <---------ANAC58<---------WOX13(2)                 <---------ANAC55(2)<--------P
------STY1(2)        <---------ANAC58--------->AHL12(2)            --------->YAB5   --------->AHL20(3)
----->STY1(2)       ---------->ID1 --------->AHL25(3)             --------->ICU4    <---------AHL20(2)
 
gccagccgttttcaatatctcttggctttttctaacttttaatttataacaattttggcattctctgaaatgagtatgtaaccatattaaaatggtaggt  2342200
       <---------AHL25(2)
       <---------AHL20(3)
       <---------AHL25(1)        ====================HOX2a_HOX2a
       <---------AHL20(2)        ------>ZmHOX2a(1)                               <-----------GT1
       --------->AHL12(3)       <---------MYB59                                --------->ARR11(3)
       --------->AHL20(3)   <------MYB83                                     <---------ATHB12
     --------->AHL12(2)     <------MYB46(1)   ------>ZmHOX2a(2)            --------->WOX13(1)
>>>>>>>>>MYB98             --------->MYB59  <---------ARR11(3)           ------------>CBF
---->ZmHOX2a(1)            <---------AtMYB61--------->GATA12<---------AHL20(2) <-----------GT1
-------MYB59            <---------REM1(1)   --------->ARR11(3)   --------->RVE1(2)   ------>ZmHOX2a(1)
->MYB59<---------AHL12(3) <--------P <----------DOF2        --------->AHL20(2)<---------ICU4
->MYB46(2)              --------->ALFIN1    <---------RVE1(2)   <---------ICU4--------->YAB1
->MYB111(1)         ---------->DOF2  <---------DAG2       <---------WOX13(2)--------->WOX13(2) <----
 
cctaacttatttttttttggtttaaaagtgtaggtcctaacttttttgatcttcttgtgtcatttaaaaatcacaaaccaattatctccttccatgtgaa  2342300
                                                                        <----------DOF2
                                                                       <---------DOF5.7(1) ---------
                                                                     --------->ARR11(3)   <---------YAB5
                                            <----------DOF2          --------->GLK1(2)    --------->ICU4
                       --------------->AtSPL8                        <---------ARR11(3)   <---------YAB1
                       --------------->AtSPL3                        <-----------ARR10  --------->YAB5
        --------->TOE1(3)                  <---------DOF5.7(1)   --------->DAG2         <---------ICU4
        --------->TOE2(3)               <---------CCA1(2)       ---------->DOF2         --------->YAB1
     <-----------GT1  <---------At5g28300------->TEIL    <---------RVE1(2)             <---------ATHB12
  <---------MYB46(3) <-----------GT1--------->TOE1(3)    --------->ARR11(3)       --------->ANAC46
-----ARR11(2)--------->ZAT6         --------->TOE2(3)    <---------ARR11(3)   ------>ZmHOX2a(1)
 
tacatttgttaccttaactctgagttactgtacattcaaccttgaatcttttgttcttgagattttaaaaagtatcttttcctccactaaatcatgattc  2342400
                                       <---------ZAT18
                                       --------->ZAT14
                                       <---------ZAT14
       <---------WOX13(2)            xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)                      ----
  --------->WOX13(2)        <---------AHL20(2)  <---------ALFIN1                               <----
  <---------WOX13(2)       <---------AHL20(2)   --------->AtMYB61   <---------ATHB12         -------
<---------AHL20(2)     <----------DOF2 --------->ZAT18  <---------ANAC46  ----------->GT1   --------
>YAB5  --------->WOX13(2)  --------->AHL25(3)  --------->MYB46(3)  --------->RVE1(2)      <---------AHL12(2)
 
tatttagtttagtttagttttgttttcttttttattttgtagtgctctcaaccactctgacttgaaaacaaatcaaaccgaaaaaaaaaaaaaaaaaaac  2342500
                                               --------->ARR11(2)
                                           --------->DOF5.7(1)
                                          --------->DOF5.7(1)
                <---------GLK1(1)         ---------->DOF2                                <-------TEIL
        --------->ANAC58              --------->ANAC58                   --------->GLK1(2)
        --------->ANAC58              --------->ANAC58                   <---------ARR11(3)
    --------->GLK1(2)             --------->ANAC58                       --------->ARR14(2)  -------
----->YAB5   <---------ATHB12     --------->ANAC58                       <---------ARR14(2)  <------
------ID1------------>CBF --------->CCA1(2)--------->DAG2     <----------DOF2------>ZmHOX2a(1)
-->MYB52(1)  --------->ICU4       ------------------------>ANAC81        --------->RVE1(2)  <-------
->DOF5.7(1)<xxxxxxxxxxxxxxxxxxxxxsmallRNA(si3) <---------ARR11(2)     <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
 
gactaagaagctagcaatgagttcccaagagatgaagaagcaagaaaaaggaaacgaagttgtcactttcgaagaaaatcctagcacttatgttcatcat  2342600
                                                                                             -------
                                                                                       --------->AHL25(1)
                                                                                       <---------AHL12(3)
     --------->DOF5.7(1)                                                               <---------AHL20(3)
     ---------->DOF2                                                                   --------->AHL20(2)
--------->ANAC58                                                             --------->AHL12(1)
--------->ANAC46                            --------->KAN4(2)                <---------AHL12(1)-----
--------->ANAC58                       <---------TOE2(3)      <------ZmHOX2a(1)   ----------->GT1---
-->YAB1                        --------->ANAC58      ----------->GT1     <---------YAB1--------->AHL20(3)
---ICU4                   --------->ZAT18  --------->KAN1 --------->ICU4 ----------->GT1     -------
--YAB5    --------->TOE2(3)    --------->ANAC58    ---------->DOF2    <---------AHL20(2)     -------
 
cacacgaaaaaagcctcaatggttttaagtgagcaagaaatagaggttattctacaaagtaataaggagacatataatgaaaaattagaaaaaaatacga  2342700
                                                                                                   <
                                                                                   --------->DOF5.7(1)
                                                          --------->AtLEC2         --------->DAG2 <-
                                                     --------->ANAC55(2)          --------->DOF5.7(1)
                                                     --------->ANAC58             <xxxxxxxxxxxxxxxxx
                                                     --------->ANAC46            ---------->DOF2 <--
                                                     --------->ANAC58          <xxxxxxxxxxxxxxxxxxxsmallRNA(si3)
                                                     <---------ANAC55(2)    --------->At4g35610  ---
-->ANAC58                                         <------ZmHOX2a(2)     <---------GATA12 --------->ATHB12
----->DOF2                                       --------->ARR11(3)     --------->GATA12--------->ANAC58
------>DOF5.7(1)<------MYB46(1)                 --------->YAB1       <---------ALFIN1   <---------YAB1
-->ANAC58       <------MYB83                 ---------->DOF2 ------->TEIL<---------At4g35610  <-----
-->ANAC46 ---------->DOF2            <-------TEIL<---------ARR11(3) <---------REM1(2)   --------->ANAC58
 
aagagaatgctgagaaagttggtattgaagaaggaaatggttcatcttcaaagatcacgccatgcattttctacacatctgatgaaaaggcacgattgag  2342800
                                                                         <---------AHL25(3)
                                                                         --------->AHL25(2)
                                                                         <---------AHL25(2)
                                                                         --------->AHL20(2)
                                                                         <---------AHL25(1)
                                                                         <---------AHL20(2)
                                                                         --------->AHL20(3)
                                                                         --------->AHL25(1)
                                                                         <---------AHL20(3)
                                                                        --------->AHL12(1)
                                                                        --------->AHL20(2)
                                                                        <---------AHL12(1)
                                                                        <---------AHL20(2)
                                                                        <---------AHL25(2)
                                                                        <---------AHL25(1)
                                                                        <---------AHL25(3)
                                                                        <---------AHL12(3)
                                                                        --------->AHL25(3)
         --------->AtMYB61                                 <---------MYB52(1) --------->TOE2(3)
   --------->ANAC58                                   --------->MYB52(1)--------->AHL12(3)         -
   --------->ANAC58                                   ------>MYB46(1)------>MYB46(1)        <-------
  xxxxxxxxxxxxxxxxxxxx>smallRNA(si3)                  ------>MYB83   ------>MYB83         <---------ICU4
--------->WRKY18(1)                                  ----------->HVH21<---------WOX13(2)  <--------HAHB4
-----------HVH21     <----------DOF2                <---------MYB111(1) --------->AHL25(1)<---------KAN1
--------MYB46(3)    <---------ANAC58                <---------MYB46(2)--------->WOX13(2) --------->ICU4
xxxxsmallRNA(si3)   <---------ANAC58                <---------MYB59<---------MYB59--------->WOX13(2)
-------AtMYB61 --------->ATHB12    ----------->GT1------->TEIL  <-----------GT1   <---------WOX13(2)
------>ALFIN1  <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)<xxxxxxxxxxxxxxxxxxxxsmallRNA(si3)   <---------YAB1
----TOE2(3)   <---------YAB1    <---------ANAC46 <---------TCP16(2)--------->TOE2(3)  <---------YAB1
 
gtggtcaagcgaccttcacgattgctttgttaatgctgtggaaaaacttggtggacctaacagttagtaacctaattaaattcttaattccgattattag  2342900
                                                                              --------->AHL20(2)
                                                                            <---------AHL20(3)
                                                                            <---------AHL25(2)
                                                                            --------->AHL25(2)
                                                                            --------->AHL20(3)
                                                                           --------->AHL12(2)
                                                                           <---------AHL12(2)
                                                        <---------ANAC46  --------->AHL25(1)
                                                        <---------ANAC58  --------->AHL20(3)
                                                  <---------YAB5          <---------AHL20(3)
                                             --------->TOE2(3)            --------->AHL20(2)
                                             <----------DOF2          --------->YAB1
                                          <-----------GT1            <---------YAB1
     <---------ANAC58                   <---------WOX13(1)         --------->WOX13(1)  <-----------GT1
     <---------ANAC58                  <---------RVE1(2)<---------ANAC58  <---------AHL20(2)       <
-------->AHL12(2)                     --------->ATHB12  <---------AtLEC2 --------->AHL20(2)  -------
--YAB1                               <---------YAB5<---------ICU4<<<<<<<<<GATA-1<-----------GT1 <---
 
tttatatttcttgagtttcttcaatatttcttcacttatattgatttactttaaacattgcatgttttatctatcataaaattatacatttctccatatt  2343000
<- Previous    Next ->

AGI:  At2g06020.1   
Description:  myb family transcription factor. similar to UNE16 (unfertilized embryo sac 16) [Arabidopsis thaliana] (TAIR:AT4G13640.2); similar to UNE16 (unfertilized embryo sac 16), transcription factor [Arabidopsis thaliana] (TAIR:AT4G13640.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO23688.1); similar to Homeodomain-related [Medicago truncatula] (GB:ABN08846.1); contains InterPro domain Homeodomain-related; (InterPro:IPR012287); contains InterPro domain Homeodomain-like (InterPro:IPR009057); contains InterPro domain Myb, DNA-binding (InterPro:IPR014778); contains InterPro domain Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR0
Range:  from: 2342532    to: 2346204    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version