AthaMap TU-Logo
Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
    --------->ANAC58                                     --------->ANAC58
    --------->ANAC58                                <----------ID1 ------>MYB83
    --------->ANAC46                                --------->DOF5.7(1)  <---------WOX13(2)
   <---------LBD16                                ---------->DOF2<---------MYB46(2) <---------YAB1
--->TOE1(3)                                 --------->YAB5 --------->ARR14(2)<---------TOE2(3)   <--
>DOF2--------->LBD16                  <------ZmHOX2a(1)  --------->ANAC58--------->WOX13(2)     ----
taaaaacccggaagagtctcatcgccatgggcaatgtgtaaggaaaacgatgaaaaagacaagatataccaaccctaattaagaattgtgagtgaatcaa  29803400
                                <---------At4g35610                                 --------->AHL20(1)
                         <---------At4g35610                                        --------->AHL20(3)
                         --------->At4g35610                                        --------->AHL25(3)
                      <------ZmHOX2a(2)                                             --------->AHL25(2)
                     --------->ARR11(3)                      <----------DOF2        <---------AHL25(2)
                     <---------GATA12          --------->ANAC58                     <---------AHL20(1)
                     --------->RVE1(2)         ----------->GT1                      <---------AHL20(2)
-------ATHB12        <---------ARR11(3)        --------->ANAC58  --------->TOE2(3)  --------->AHL20(2)
----->RVE1(2)    ---------->DOF2--------->At4g35610 <---------WOX13(2)         --------->AHL20(2)<--
atcaaacacaaactcaaactcaaagatcagctcttagctcaaactcagagacgaaaattgaaaacttttcttaaaccccaaattcaatatatttaaagtt  29803500
   --------->AHL25(1)                                               <---------HSFB2a(1)
   <---------AHL25(3)                                               <---------AtMYB61
   <---------AHL20(2)                                          --------->ANAC58
   <---------AHL12(3)                                          --------->ANAC58
   --------->AHL25(3)                ----------->RAV1(1)      --------->SPL7(1)
   <---------AHL25(1)             --------->ANAC58           --------->MYB52(1)
  --------->AHL20(2)              --------->ANAC46         ------>ZmHOX2a(2)
--------->WOX13(2)                --------->ANAC58       <---------ARR11(2)
<---------WOX13(2)              ---------->DOF2          --------->ARR11(2)
-TOE2(3)                       --------->YAB1            <---------GATA12
-TOE1(3)                    --------->WOX13(1)           --------->GATA12                        ---
>DOF2                     <---------ATHB12   <----------DOF2<---------SPL7(1)    --------->DOF5.7(1)
-------YAB1   ---------->DOF2 <---------ATHB12   <---------RVE1(2)  <---------YAB5               ---
atcaatttaaattcaacaaaagaaacccattcaatcaaagcaacatacctttgatatatggatcgaacggaatggtcgcaagagaagagagagagaagag  29803600
                                                       ------>NtERF2                      <---------RAP2.3(3)
                                                      --------->ANAC46                    <---------DEAR3(1)
                                                      <---------bZIP60(1)                 --------->DEAR3(1)
                                                      --------->ANAC58                    <---------RRTF1(3)
                                       --------->DOF5.7(1)                                <---------RAP2.3(2)
          <---------KAN1      <---------ANAC58        --------->ANAC58                   <---------ABI4(1)
          <---------AHL12(1)  <---------ANAC58     ----------->TGA1                   --------->DOF5.7(1)
          --------->AHL12(1) --------->MYB52(2)    ----------->HVH21                 --------->MYB52(1)
------>ANAC58    <---------At4g35610 ---------->DOF2  --------->bZIP60(1)  *TSS   --------->AtMYB61<
------>ANAC58  <-----------GT1<---------ANAC46  --------->GLK1(2)      ------------------------>ANAC81
acccaagtgaagaatttttaagctctcaaggtttcttgcacaaagggtgagagtctgacgccagaaaacgagagaaacaaaaaaaccaaaacggcggcgt  29803700
                                                   <----------DOF2        <---------AHL25(1)
                                              --------->ARR11(3)          --------->AHL20(3)
                                          <---------AHL20(2)              --------->AHL25(1)
                                        <---------AHL12(2)                <---------AHL25(3)
                                        --------->AHL12(2)                <---------AHL20(3)
                                       <---------ARR11(3)                 --------->AHL12(3)
                                       <---------AHL20(3)                 <---------AHL12(3)
                                       --------->AHL20(2)                 --------->AHL12(1)
                                       --------->AHL25(2)                 <---------AHL12(1)
                                       --------->AHL20(1)                 <---------AHL20(2)
---ANAC46                <---------ANAC55(2)  <---------ARR11(3)          --------->AHL20(2)
-ERF1  ------------>AtMYB77            <---------AHL20(1)                <---------AHL20(2)
-RAP2.3(1)               --------->ANAC55(2) <---------CCA1(2)           --------->AHL25(3)
-ORA47(2)                --------->YAB1<---------AHL25(2)               <---------AHL12(2)
-ATERF1(1)         <---------ARR11(3)  --------->AHL20(3)               --------->AHL12(2)
-DEAR4(2)          ------->TEIL        <---------AHL12(1)        <---------ALFIN1          ---------
-RRTF1(1)         <---------CCA1(2)    --------->AHL12(1)     <-----------GT1 <-----------GT1  <----
-----------GT1<---------At5g28300 ------------>CBF<---------DOF5.7(1) --------->AHL20(2)   <--------
tttaacaacttcacagttactgtatcttacataatagtccaatattttatatctcttttcagtttgaaccacattatttatttactacccctagtcccct  29803800
                  <---------ALFIN1                                                               <--
                 ----------->HVH21                                                               <--
              ------>NtERF2                                           ------>ZmHOX2a(1)          <--
             --------->ANAC58             <---------ARR14(2)        <---------DOF5.7(1)         <---
>ZAT18       --------->ANAC58             --------->ARR14(2)       ------>NtERF2              <-----
-----ALFIN1  --------->ANAC46         xxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)     ----------->HVH21<----
-ZAT18     <---------ALFIN1*TSS ----------->RAV1(2)               --------->DEAR3(1)       ------>ZmHOX2a(1)
actctctctcgcttccacgcccgactcggactcaaacctggtccgaattggctgtgtctctctccatcgcctccttcttctctgacaaactctcctccgt  29803900
  <------NtERF2                       --------->ZAT14
<---------DEAR3(1)                 <---------ANAC46
--------->ETT(1)                   <---------ANAC58
----MYB83                         <-------TEIL
----MYB46(1)                   <---------HSFC1(2)                                              <----
-------MYB46(3)                --------->HSFC1(2)                                              -----
------AtMYB61                 --------->ANAC58              <-----------GT1                   ------
--GAMYB                       --------->ANAC58  <---------YAB5         <---------LBD16      --------
-----MYB52(1)     <---------TOE1(2)<---------ANAC58      <---------DOF5.7(1)                <-------
tggtcggagtttgtttcttcgctcgttcatcacaagcttcgtgtactggtaattgttccattttttctagctatttcggaaaattggatggaagaagcat  29804000
      <---------ANAC46                                                          <-----------GT1
    <---------ANAC55(2)                                                   <---------MYB52(1)
  --------->KAN1              <-------GAMYB                              <---------DOF5.7(1)
-----At4g35610               <---------MYB46(3)                          <----------DOF2
---->At4g35610               <---------ANAC46                   <---------ARR14(2)
--->GLK1(2)               <-----------RAV1(1)                   --------->ARR14(2)      ----------->GT1
->HSFC1(2)        <---------At4g35610  <------NtERF2           --------->AHL12(1)     <---------MYB52(1)
--HSFC1(2)    <-----------RAV1(1) <---------TOE2(3)<---------RVE1(2)    <---------DOF5.7(1)
ctgaaatacgcgtgtaaatgtcgctgattgtgtcgttgaggcagagccattgttgattcttagagaaaatttgctcctttatttctccagtttgttaaac  29804100
                                     <---------HSFB2a(1)                                      <-----
                                     --------->HSFC1(2)                                 --------->DOF5.7(1)
                                     --------->HSFB2a(1)                              ---------->DOF2
                 <-------TEIL        <---------HSFC1(2)  <---------YAB1          <-----------HVH21--
     --------->ANAC58      --------->LBD16              <---------GLK1(2)       <------MYB46(1) <---
     --------->ANAC58     <---------LBD16            --------->YAB1         <---------ZAT2   <------MYB83
  --------->ARR11(2)     <---------LBD16     <---------At4g35610            --------->ZAT2   <------
  <---------ARR11(2)  ----------->HVH21      --------->At4g35610 <-----------GT1<------MYB83 <------MYB46(1)
tctcgattacgcccttgaaatgcattcgaccgggaagagaaatttcttagctgttatcagattattgtttactagttcgagcttggtcagaaaggctggt  29804200
                                --------->KAN1                                   --------->GATA12
                                --------->ALFIN1                            --------->GLK1(2)
   <---------GATA12     --------->MYB46(3)             <---------GATA12    <---------ARR14(2)
  <---------GLK1(1) <----------DOF2                    ------->TEIL        <---------ARR11(2)
--------HSFB2a(2)  --------->TOE2(3)                   --------->GLK1(2)   --------->ARR14(2)
--GAMYB   --------->ARR14(2)<-----------RAV1(2)      --------->YAB5        <---------GLK1(2)  <-----
------->HSFB2a(2)  <---------DOF5.7(1)      <---------YAB1                <------ZmHOX2a(1)---------
------REM1(1) <---------At4g35610         --------->KAN1                  ================HOX2a_HOX2a
---MYB46(3)   --------->At4g35610        <---------MYB52(1)             <---------TOE2(3)  <--------
tgtagaaatctcatttctgctacctttaccaccaggtgttcgacgttatgcctgaatgaatctgaagaatgcattgaggattctgatctatcgtctagga  29804300
<- Previous    Next ->

AGI:  At1g79210.1   
Description:  20S proteasome alpha subunit B, putative. Identical to Proteasome subunit alpha type-2-B (PAB2) [Arabidopsis Thaliana] (GB:Q8L4A7;GB:O64532); similar to PAB1 (PROTEASOME SUBUNIT PAB1), peptidase [Arabidopsis thaliana] (TAIR:AT1G16470.2); similar to PAB1 (PROTEASOME SUBUNIT PAB1), peptidase [Arabidopsis thaliana] (TAIR:AT1G16470.1); similar to unknown [Populus trichocarpa] (GB:ABK93363.1); contains InterPro domain Proteasome alpha-subunit, conserved site; (InterPro:IPR000426); contains InterPro domain 20S proteasome, A and B subunits; (InterPro:IPR001353)
Range:  from: 29800974    to: 29803676    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
AGI:  At1g79220.1   
Description:  mitochondrial transcription termination factor family protein / mTERF family protein. similar to mitochondrial transcription termination factor-related / mTERF-related [Arabidopsis thaliana] (TAIR:AT5G64950.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO47894.1); contains InterPro domain Mitochodrial transcription termination factor-related (InterPro:IPR003690)
Range:  from: 29803828    to: 29805418    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version