AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                    --------->GATA12
                                                                                    <---------GATA12
                                                         ----------->GT1            --------->ARR14(2)
                                                    <---------DEAR3(1)              <---------ARR11(2)
                                                    ------>ZmHOX2a(2)               <---------ARR14(2)
                                                  <---------ARR11(2)            <-----------------AGL1
                                                  <---------ARR14(2)          <---------RAP2.6(2)
                                                  <---------RVE1(2)         <-----------RAV1(1)
                                                  --------->ARR11(2)    <---------AHL20(2)
-------ANAC58                                     --------->GATA12   --------->YAB1<---------RAP2.6(3)
-------ANAC58                                     --------->ARR14(2) --------->TOE2(3)        <-----
-GT1          <---------ZAT18                     <---------GATA12 <---------ARR11(3)         <-----
 
gcttgaagagcaatttgttcacttgagttagaagttgaaaatgaattgttttggatcggtgagttaaaactatcttaaattgtggccgatttggcaatat  27494400
                           --------->ARR11(3)
                           <---------ARR11(3)
                          --------->KAN1
                          --------->GLK1(1)
                         <---------RVE1(2)
                   <---------GLK1(2)
                   <---------RVE1(2)
                 <---------YAB1
              --------->GLK1(2)
             <---------RVE1(2)
             --------->ARR11(3)     <----------ID1     <-----------GT1
           ----------->ARR10   ------>ZmHOX2a(1)    <---------ZAT6
       ----------->GT1 <---------YAB1       <---------AHL25(3)             --------->ANAC55(2)
----ARR11(3) <---------GLK1(2) <----------DOF2<---------YAB1               <---------ANAC55(2)  <---
----AHL20(1)--------->KAN1<---------GLK1(1) --------->YAB1 --------->ANAC46--------->YAB1  <--------
 
atgttgtaagtagtaagattctgattctgatatccttttaagacaaattatactagtattacaagactcaatcttcttacataatacaaaattcagttca  27494500
                                                              <-----------GT1
                                                       <---------HSFB2a(2)
                                                       --------->HSFB2a(2)
                                                 --------->RVE1(2)
                                --------->YAB1   --------->ARR11(3)
                                --------->AHL20(2)  <----------DOF2
                              <---------AHL12(2) <---------AHL20(1)
      >>>>>>>>>SARD1<------ZmHOX2a(1)            --------->AHL20(1)       --------->YAB5
      >>>>>>>>>CBP60g  ----------->GT1           <---------ARR11(3)  --------->CCA1(2)
------YAB5      --------->DOF5.7(1)             --------->CCA1(1)   <---------ARR11(3)
-At4g35610 ----------->GT1   --------->YAB1     --------->RVE1(1)   --------->ARR11(3)        <-----
 
tggttcgaaatttggagtaaaaaggattgaaataataaaaaaaacattcaaatatcttttggaaataacaagatatatgactctgttttcatgtatagat  27494600
                       <---------MYB46(3)
                       ----------->GT1
                      <---------ANAC46            --------->ZAT14
                    <---------MYB46(3)     --------->bZIP60(1)
                   --------->ALFIN1        <---------bZIP60(1)
                <---------AtMYB61     ----------->GT1                      --------->DAG2
          <----------DOF2            --------->DOF5.7(1)                   --------->DOF5.7(1)
         <---------DOF5.7(1)         --------->DAG2                 ---------->DOF2
     <---------YAB5<---------AtMYB61---------->DOF2             ---------->DOF2                    <
----GLK1(2)  --------->ATHB12       --------->DOF5.7(1)--------->ANAC46  ---------->DOF2   <--------
 
tgttgtgcatcatctttcattggtggtggataaaaaaaaaaaagtgacaacagtttacacgaagaccgaaagaaaggaaaggtagcaataggttgtgtaa  27494700
                                                        --------->ANAC58
                                                        --------->ANAC58
                                                     ----------->HVH21
                                                     ----------->TGA1
                                               <---------ANAC46
                                              <------NtERF2
                                              --------->ATERF1(1)
                                              <---------LBD16
                                             <---------RAP2.3(1)
                                             <---------RRTF1(1)
                                             <---------ERF1
                                             ------>NtERF2
                                            <---------RAP2.3(2)
                                            <---------RAP2.3(3)
                                            <---------RRTF1(3)                   <---------ARR11(2)
                                            <---------RAP2.6(2)                  <---------GLK1(2)
                       --------->ANAC46     --------->ATERF1(2)                  --------->ARR11(2)
                       --------->ANAC58     <---------RRTF1(2)                   --------->ARR14(2)
               <---------ICU4               <---------DEAR3(1)            ------->GAMYB
              <---------YAB5                <---------ATERF1(2)    --------->GATA12
              <---------YAB1     <---------KAN1<---------DEAR3(1)  ------->TEIL  <---------ARR14(2)
            --------->YAB1      <---------ARR14(2) <---------At4g35610   --------->MYB46(3)
            <---------ICU4      --------->GLK1(2)<------NtERF2     --------->RVE1(2)               -
      <---------At4g35610       --------->ARR14(2) --------->At4g35610 --------->MYB52(1)          -
---------AHL12(1)      --------->ANAC58  ----------->HVH21         <---------GATA12              ---
-ANAC46    <---------YAB5      <---------GLK1(2)--------->LBD16   <---------CCA1(2)           ------
 
gaaaatttcatctcatcatcattttcaagacacagaatatggttttgacggcggagatgacgcaaacgtgaatctaacggaccgtattctctctgtaaca  27494800
                                                                         <---------O2
                                                                         --------->ANAC58
                                                                         --------->ANAC58
                                                                    --------->ZAT14
                                                                    <---------ZAT14
                                    --------->ARR14(2)       <---------ANAC58
                                    <---------ARR14(2)       <---------DEAR3(1)
                                    --------->RVE1(2)        <---------ANAC58
         <---------ANAC58           <---------GATA12      --------->DOF5.7(1)
    <----------DOF2                 --------->GATA12     --------->DOF5.7(1)         <---------ANAC58
   <---------DOF5.7(1)          <<<<<<<<<<WRKY63       ---------->DOF2   --------->ANAC55(2)
----->MYB46(1)    --------->At4g35610               --------->WOX13(2)   --------->ANAC55(1)
----->MYB83       ----------->RAV1(2)               <---------WOX13(2)   --------->ANAC46===========
------>AtMYB61    <---------At4g35610       *TSS    <---------TOE2(3) <---------REM1(2)  <----------DOF2
--->ZAT6 <---------ANAC58     ----------->GT1   <----------DOF2<------NtERF2         <---------ANAC58
 
ccaacgtcttttgcttatttcatctgtagcaaatagtcaaatctgaaaatgctttaatgaaagggcgtctctgtacacgtagccacttgcttctttcact  27494900
               <---------YAB5
            <------ZmHOX2a(1)
       <-----------HVH21               <---------LBD16
       <-----------TGA1         <---------YAB5
      ================================bZIP_DOF
      <---------TGA1a         --------->YAB1                                             --------->YAB1
      --------->TGA1a      <----------DOF2                                              <---------YAB5
      --------->O2     <---------At4g35610<---------MYB52(1)          <---------ZAT18  <-----------GT1
  <xxxxxxxxxxxxxxxxxxxxsmallRNA(le3)  ------>ZmHOX2a(1)          <---------LBD16      <-----------GT1
================bZIP_DOF  <---------DOF5.7(1)                 --------->KAN1<---------WOX13(2)
 
ctctctctctcgtcaggaatcgtctctgctctttcatcatcctccggtctctctctccctctctctaattcggagcgctaatttctgttttatcatcttc  27495000
                                                           ----------->GT1
                                              ------>ZmHOX2a(2)
                                              ====================================HOX2a_HOX2a
                                             =====================================HOX2a_HOX2a      <
                                             <------ZmHOX2a(2)                                    --
                                            --------->GATA12                                     <--
                                            <---------ARR11(3)                                  <---
                                            --------->ARR14(2)                                  ----
                                            <---------GATA12                                    ----
                                            --------->ARR11(2)                                  <---
                                            <---------ARR14(2)                                  <---
                                            --------->ARR11(3)             =========================
                                    --------->DAG2       --------->DOF5.7(1)                    ----
                                <---------AHL25(3)       --------->DAG2    ------>ZmHOX2a(1)    <---
                                --------->AHL20(2)      --------->DOF5.7(1)--------->LBD16      ----
                       <------MYB46(1)      <---------ARR11(2)   <----------DOF2                ----
                       <------MYB83---------->DOF2      ---------->DOF2    =========================
                      --------->MYB59       <---------RVE1(2)    <---------DAG2             --------
               <---------AtLEC2--------->AHL20(2)  --------->AtLEC2    <-----------GT1    <---------KAN1
 
ttgagggttcttctagttgcatagctaggtctaaataaaaaagtagggatcttgatgcaaaaaggaaacttttttttcctggtttccctaggcatgaaag  27495100
   <------MYB83
   <------MYB46(1)
  <---------AtMYB61
 <---------MYB52(1)
-----------RAV1(1)
---->ZmHOX2a(2)
----ZmHOX2a(2)
------GATA12
----->ARR11(3)
----->ARR14(2)
------ARR11(3)
------ARR14(2)                                                          --------->ANAC58
=====HOX2a_HOX2a                                                    <---------------------WRI1
----->RVE1(2)              <---------WOX13(2)                <---------------AGL15         <--------
------AGP1                 --------->WOX13(2)                --------------->AGL15       --------->DAG2
----->GATA12           <----------DOF2                      ----------------->AGL1   --------->ANAC58
----->AGP1         <---------ZAT18                 --------->ARR11(3)   --------->ANAC58---------->DOF2
====HOX2a_HOX2a <-----------RAV1(1)           <-------TEIL<-----------GT1            --------->ANAC58
-->DOF2       <---------KAN1    <----------DOF2  <---------YAB1   <---------LBD16   <---------------
 
atctgttggtgtttagaatttgtgggcttcaattactttgacttctaggttgatgattttgttacattttgggggaagtaatctatgaacgaaaagcaca  27495200
                                     --------->MYB59
                                     <---------TOE1(3)
                       <----------DOF2
                       <---------DAG2<---------TOE2(3)     <---------CCA1(2)
            ------>ZmHOX2a(1)    ------->TEIL      --------->DOF5.7(1)
           <---------ANAC58    <-------TEIL        --------->DAG2
--ID1 --------->KAN1   <---------DOF5.7(1)        ---------->DOF2          --------->RVE1(2)
------WRI1 <---------ANAC58  --------->GATA12--------->AtLEC2             --------->GLK1(1)
 
aactgctatgtattccttacgaagcgcttttagatgcatttaggttttatgcaaaaagtcccataacttgttgtctgatatcaaagttttcattttggga  27495300
<- Previous    Next ->

AGI:  At1g73090.1   
Description:  similar to unnamed protein product [Vitis vinifera] (GB:CAO23197.1)
Range:  from: 27491878    to: 27494427    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
AGI:  At1g73100.1   
Description:  SUVH3 (SU(VAR)3-9 HOMOLOG 3). Identical to Histone-lysine N-methyltransferase, H3 lysine-9 specific SUVH3 (SUVH3) [Arabidopsis Thaliana] (GB:Q9C5P4;GB:Q9SSL7); similar to SUVH1 (SU(VAR)3-9 HOMOLOG 1) [Arabidopsis thaliana] (TAIR:AT5G04940.1); similar to SUVH1 (SU(VAR)3-9 HOMOLOG 1) [Arabidopsis thaliana] (TAIR:AT5G04940.2); similar to unnamed protein product [Vitis vinifera] (GB:CAO46198.1); contains InterPro domain Pre-SET zinc-binding region; (InterPro:IPR007728); contains InterPro domain SRA-YDG (InterPro:IPR003105); contains InterPro domain Post-SET zinc-binding region; (InterPro:IPR003616); contains InterPro domain Pre-SET zinc-binding
Range:  from: 27494845    to: 27497843    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version