AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
      ------>ZmHOX2a(2)
    <---------RVE1(2)                                                         <---------DOF5.7(1)
    --------->ARR11(3)                                                       <---------DOF5.7(1)
    <---------ARR11(3)                                                  <----------DOF2
    <---------GATA12                                                   <---------DOF5.7(1)
---------ANAC46                                                      <-----------GT1
----bZIP60(2)               <<<<<<<<<TBF1                           <---------CCA1(2)
>DEAR3(1)            <-----------GT1                            <---------ANAC46
-->HVH21          ----------->GT1       ------>ZmHOX2a(1)      ---------->ID1<----------DOF2
 
ttgccttgatcttagaacacagtgtaacttcttcttcccattcctcatcttcatcaacttctacttgtcgtttatctttccttttactactaacatcaga  23042600
                        --------->At4g35610
                        <---------ANAC55(2)
                        --------->ANAC55(2)
                   --------->YAB1
                   --------->YAB5
                   <---------ICU4                                                                ---
                  --------->ICU4         --------->TOE1(3)                                       ---
                  <---------ATHB12       --------->YAB1                     <----------DOF2<--------
                  <---------YAB5         --------->TOE2(3)                  ------>ZmHOX2a(1)   ----
              <---------ZAT18      --------->TOE2(3)                   --------->WOX13(1)  ---------
      --------->ANAC55(2) ----------->HVH21                          <---------YAB1        ------>ZmHOX2a(1)
     -------->P --------->WOX13(1) --------->YAB1                   --------->RVE1(2)      ---------
   <---------MYB111(2)  ----------->RAV1(2)                    <---------ANAC46      --------->KAN1
   <---------MYB111(1)  <---------At4g35610                 <---------MYB52(1)     <---------TOE1(2)
 
aaaccacttacctattgtgcaatcatcacctgactctatcttaaccataacttcaacttcttcgttgcgcttatcaatccttttcgcagtattcctctga  23042700
                                                             <---------TOE1(2)
                               --------->AHL25(2) <---------ARR11(1)
                               --------->AHL20(3) --------->ARR11(3)
     <---------ANAC55(2)      --------->YAB1      <---------ARR11(3)
     --------->ANAC55(2)   --------->YAB1         <---------ARR11(2)                     <---------YAB5
  <---------ATHB12  <---------YAB5                <-----------ARR10                --------->At4g35610
--------->WOX13(1)--------->YAB1                  --------->ARR14(2)               <---------At4g35610
------>ANAC58     --------->YAB5                  <---------ARR14(2)             --------->MYB46(3)
------>ANAC58     <---------ICU4--------->KAN1    --------->RVE1(2)             <---------At5g28300
-At4g35610       --------->ICU4<---------AHL25(2)<---------CCA1(2)        <---------ANAC58
--->TEIL         <---------ATHB12              <---------AtLEC2           <---------ANAC46--------->YAB1
>At4g35610       <---------YAB5<---------AHL20(3)<---------GLK1(1)        <---------ANAC58<---------ICU4
-->RAV1(2)     --------->WOX13(1)          <----------DOF2  ------>ZmHOX2a(1)  <-----------GT1
 
acccaatcacttaatatgcaatcatcatcttcataatattcttctactttgcatatctttctccttcgtttcgcattccgtttaaccgctgaatcatcgc  23042800
                      --------->ARR14(2)
                      <---------ARR11(2)
                      --------->ARR11(2)
                     <---------MYB52(1)
                   <---------ANAC58
              <---------HSFB2a(1)
              --------->HSFB2a(1)
              --------->HSFC1(2)
              <---------HSFC1(2)
           ---------->DOF2
        --------->HSFB2a(2)                                          <---------YAB5
        <---------HSFB2a(2)     --------->YAB5                    --------->ATHB12
    --------->ZAT2 <---------ANAC58                     <---------DAG2                         <----
    --------->At4g35610         --------->ZAT6          <---------DOF5.7(1)                 ------>ZmHOX2a(1)
    <---------At4g35610   ------>ZmHOX2a(1)          <<<<<<<ZML2 <---------YAB1--------->GLK1(1)
 
tatcttcagctctcgaaagcttccgtttcctactatcactactactactagggctagaaccttttgacatgaatggtttcagagttctcttcttcctagt  23042900
                                                        --------->RVE1(2)
                                                        --------->GLK1(2)
                                                        --------->ARR14(2)
                   <---------WOX13(2)                   <---------ARR14(2)
                 <---------YAB1                        <---------GLK1(2)
                <---------ARR11(3)             <-----------GT1
                --------->ARR11(3)           --------->AHL20(2)          ------>ZmHOX2a(1)
      <---------KAN1                       --------->WOX13(2)          ----------->RAV1(2)
  --------->ANAC46--------->ATHB12         <---------WOX13(2)   <----------DOF2   ---------->DOF2
-----YAB5 --------->YAB1          --------->KAN1     --------->LBD16<---------At4g35610         ----
 
cgtccacgaatattgataagataattggaaacaattcatatgctccaatttaactccagaatccattctttagctcctgcaaacaaaaatcgccagtgat  23043000
                   --------->ARR14(2)
                   <---------ARR14(2)
        ------>ZmHOX2a(2)
       <------ZmHOX2a(2)
      <---------ARR11(2)
      --------->ARR11(2)
      --------->ARR14(2)                                          >>>>>>>>>RAP2.2
      --------->ARR11(3)                                        <---------ARR11(3)
      <---------ARR14(2)                                <---------ARR14(2)
      <---------ARR11(3)                                --------->ARR14(2)
      --------->RVE1(2)                                 --------->GATA12
      <---------GATA12                                  <---------GATA12
      --------->GATA12                                  <---------RVE1(2)
      --------->AGP1        --------->ANAC46            <---------ARR11(2)
      <---------AGP1--------->GLK1(2)              --------->AtLEC2                         --------
     <---------CCA1(2)    --------->REM1(1)     ------->TEIL    --------->RVE1(2)          <--------
<---------WOX13(2) <---------GLK1(2)       --------->MYB52(1)   --------->ARR11(3)         ---------
------->GT1       --------->KAN1 <------------CBF<---------KAN1<---------KAN1      --------->KAN1  <
 
ggtaattcagatctatgaaacagattcttacaccaaaattgaaacaaaacgaacatgcagatttgaatatctaaaacagagacaacaaattcgagttctt  23043100
            --------->AHL20(2)
            <---------AHL20(2)
            --------->AHL25(1)
            <---------AHL25(1)
            <---------AHL12(1)
            --------->AHL12(1)
            <---------AHL25(3)
           <---------AHL12(2)
           <---------AHL25(1)
           --------->AHL20(2)
           --------->AHL12(3)
           --------->AHL25(2)
           --------->AHL25(3)
          <---------WOX13(2)
    --------->RVE1(2)                                                                  ---------->DOF2
   <---------ICU4                                                              --------->RVE1(2)
  <---------YAB1                                   --------->YAB1             ------>MYB83      ----
  --------->ICU4                                  <---------ATHB12   <---------YAB1  --------->YAB1
--------->YAB5        --------->AHL20(2)      ------------>CBF   --------->TOE2(3)  <---------ATHB12
--------->YAB1   ------------>CBF       <---------ATHB12      ----------->RAV1(1) --------->WOX13(1)
->KAN1--------->YAB1  ---------->DOF2 --------->WOX13(1)   ------>MYB46(1)    ------>MYB46(1)-------
-ARR11(3) --------->WOX13(2)        ------------>CBF       ------>MYB83<---------AHL20(2)--------->DOF5.7(1)
>ARR11(3) --------->AHL12(2)  --------->ARR14(2) --------->RVE1(2)--------->ICU4------------>CBF<---
------ZmHOX2a(2)--------->YAB1<---------ARR14(2)--------->WOX13(1)<---------YAB1<---------ATHB12<---
 
cgatcataatcaaaattaatcgcaataaaacagtatatgatcaatcgattccaatcaaaaccaaacaacattattaaaaccaaatcaatcaaaagagaca  23043200
        <------------CBF   <------ZmHOX2a(2)
    <---------------AGL15 --------->GATA12        --------->YAB1
    <---------HSFB2a(2)   --------->ARR11(3)      --------->YAB5
    =========================================================MADS_MADS
    --------->HSFB2a(2)   <---------GATA12       <---------YAB1
   <-----------------AGL1 --------->RVE1(2)  --------------->AGL15                    <---------GLK1(1)
   ----------------->AGL2 <---------ARR11(3) <---------DAG2                          <---------ARR11(3)
----->WOX13(2)     --------->At4g35610       <---------------AGL15                   --------->ARR11(3)
----->CBF        --------->YAB1              --------->TOE2(3)              --------->ANAC58    ----
---------CBF  --------->GLK1(1)           <-----------GT1                   --------->ANAC58   -----
------WOX13(2)<---------GLK1(1)    ------------>CBF              ----------->GT1    <---------KAN1 -
 
attgagtctagaattggaaatcagaagaagatcgaaaactcaattttaccttatgatgaacacaaacacagaaaaaaacaagctcgaagaactctgcaac  23043300
                                        --------->ZAT2
       ------>ZmHOX2a(1)          <---------GATA12                                         <--------
     ----------->RAV1(2)          --------->GATA12   ---------->DOF2       <---------GLK1(2)
 <---------GATA12                --------->KAN1  --------->At4g35610       --------->ARR11(2)
 ------->TEIL             <-----------GT1        <---------At4g35610       <---------ARR14(2)     <-
----->YAB5         --------->GATA12     --------->At4g35610                --------->ARR14(2)    <--
---->ICU4          <---------GATA12     <---------At4g35610                <---------RVE1(2)<-------
-------->YAB5      --------->RVE1(2)    <---------ZAT2                     --------->GATA12<--------
 
gatgaatctcctgtgaaaaacaaatctataaaccctagattccagctaagttagatgaaagagattgaacaaactttggattctctcaaacttagctttc  23043400
                                                               --------->MYB59
                                                        --------->HSFB2a(2)
                                                        --------------->AGL15
                                                        <---------------AGL15
                                                        <---------HSFB2a(2)
                         ---------->DOF2               ----------------->AGL2  <---------ANAC58
                         --------->DOF5.7(1)        <---------ARR11(3)         <---------ANAC58
                    <----------ID1                  --------->ARR11(3)       --------->ARR11(3) <---
                   ----------->GT1                  --------->RVE1(2)----------->GT1          ------
      --------->YAB1----------->GT1                --------->CCA1(1)--------->DOF5.7(1) ----------->GT1
--------->AHL25(3) <---------TOE2(3)               --------->RVE1(1)--------->DAG2     <---------ANAC55(2)
-ANAC58     --------------->AGL15         <---------LBD16--------->LBD16   --------->AHL12(2) ------
--------DOF5.7(1)---------->DOF2       --------->KAN1  <---------LBD16----------->GT1  --------->ANAC46
--------DOF2<---------------AGL15  ----------->GT1 --------->KAN1  ---------->DOF2     --------->ANAC58
---DOF2     ============================================================MADS_MADS      --------->ANAC58
-ANAC58  --------->MYB52(1)--------->DOF5.7(1)     <---------KAN1<------ZmHOX2a(1)    <---------LBD16
 
ctttttatttcataactgaataaaggaaaaaagagaaatagtttattcggagaaatatcccagaattaggaaaaggaaaatttcttgagcacggaaaaaa  23043500
<- Previous    Next ->

AGI:  At1g62310.1   
Description:  transcription factor jumonji (jmjC) domain-containing protein. similar to transcription factor [Arabidopsis thaliana] (TAIR:AT1G11950.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO44407.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO69660.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN60121.1); contains InterPro domain Transcription factor jumonji (InterPro:IPR013129); contains InterPro domain Transcription factor jumonji/aspartyl beta-hydroxylase (InterPro:IPR003347); contains InterPro domain Zinc finger, RING-type; (InterPro:IPR001841)
Range:  from: 23039704    to: 23042966    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version