AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
        <---------ANAC58   --------->ARR11(2)
     <---------GATA12      <---------ARR11(2)
     <---------ARR11(2)------->MYC2
-----------RAV1(2)     <-------MYC2                                                              ---
----TEIL<---------ANAC58--------->ALFIN1                                                        ----
------ZAT14            ------->MYC3                                       --------->DOF5.7(1)   <---
------->HVH21    --------->YAB1   <---------YAB5                         --------->DOF5.7(1)    ----
----->ZAT14    --------->RVE1(2)  <---------YAB1       <---------GLK1(1)--------->DOF5.7(1)     <---
-------HVH21   --------->GLK1(2)  --------->ICU4     <------ZmHOX2a(1) ---------->DOF2         <----
--GT1--------->ARR11(2)<-------MYC3               <---------LBD16---------->DOF2     <---------ANAC46
 
tcacaggggatgcgagagaatcagaacgtggatgctcatgatcaagagaaaactcaggaactcggtttcaaaggaaaagagggagatggagtttaagagg  10335500
       <---------ANAC55(2)
       --------->ANAC55(2)
      <-----------------------TaNAC69(2)
     --------->CCA1(2)                             --------->ANAC46                        <-------TEIL
     <-----------GT1                               --------->ANAC58                 --------->YAB1
------>MYB52(1)                                --------->ANAC46              --------->ANAC58
----->ARR11(2)                                <---------LBD16                --------->ANAC58
------ARR11(2)     --------->DOF5.7(1)       <---------At5g28300       <----------DOF2 <---------ICU4
----->ARR14(2)   ---------->DOF2         <----------DOF2    <---------ANAC46 --------->ANAC46    <--
------ARR14(2)  --------->AtMYB61  --------->ATHB12--------->ANAC58<-----------GT1 --------->AHL20(2)
--ZmHOX2a(1) --------->AtMYB61    <---------YAB1--------->LBD16 ----------------------->TaNAC69(2)
 
aaacggagttacgagaccaccaaagagaactctcaagatgatttcttttaccgcaagaaactgatgtgtttttcctttgaacgcaaataataagttcatt  10335600
                                                                      <---------AHL25(3)
                                                                      <---------AHL25(1)
                                                                      <---------AHL12(3)
                                                                      --------->AHL12(1)
                                                                      <---------AHL12(1)
                                                                     <---------AHL12(1)
                                                                     <---------ARR11(3)
                                     --------->ATHB12                --------->AHL12(1)
                                     --------->YAB5      <----------DOF2
                                  <------------CBF <---------YAB1    --------->AHL25(3)
                      <------------CBF           --------->YAB5      <---------AHL20(1)
                   <---------YAB5--------->ATHB12--------->YAB1      --------->AHL20(1)
                   ------------>CBF<---------WOX13(1) ------->TEIL   <---------AHL25(2)
            <---------ARR11(2)  <---------YAB5  <---------KAN1       --------->AHL20(3)     <-------
         ------>ZmHOX2a(2)<---------ZAT6        --------->ICU4 --------->AtLEC2     --------->MYB52(1)
-------YAB1 --------->ARR11(2)<------------CBF  <---------ATHB12     --------->AHL25(2)  <---------MYB52(1)
 
ttgataaactgatcgtttcggaatcaattgtgttattgattgattaaacgaatgatgaaacttttaatgcaaaatatttgaacaaaataactgttattta  10335700
                                        --------->ANAC58   --------->DEAR3(1)
                                        --------->ANAC58  <------NtERF2                       <-----
                                        --------->ANAC46  --------->RAP2.3(1)                -------
                                     <---------ARR14(2)  ------>NtERF2                       <------
                  <------------CBF   --------->ARR14(2)  --------->LBD16                     <------
         ------------>CBF      <----------ID1           --------->ANAC46                     -------
        --------->RVE1(2)    ---------->DOF2 ----------->HVH21                            --------->YAB5
---------->DOF2 <---------RVE1(2) >>>>>>>>>>GT-3b      <---------LBD16     ------------>CBF  -------
--WOX13(2)    --------->RVE1(2)----------->GT1--------->MYB52(1)     ---------->DOF2   <----------DOF2
 
gaagaaagaaatatcaatagctattgaagataaaaagaaaaatacgccctaacagtttcccgccgaaaaaactaaagaaacaataccattctttgattaa  10335800
                                       >>>>>>>>>WRKY18
----AHL20(2)                        <------------CBF                  <------ZmHOX2a(1)
-->AHL25(3)                       <---------YAB1                  <---------TOE1(1)
---AHL25(1)                <------------CBF                       <---------TOE2(1)
---AHL20(2)               <---------KAN1<---------TOE2(3)      --------->ARR11(2)
-->AHL20(2)              --------->GLK1(2)   --------->DOF5.7(1)--------->CCA1(2)       ------------
-->AHL25(1)              <---------ARR14(2)---------->DOF2     <---------ARR11(2)      --------->TOE2(3)
 
atagagaaacaaaaacagcattagagagaatattgttagcattgacgaaagagagtcgaagagactgatacgaggagaactcactctcaacttcaatggc  10335900
                                                            ---------->DOF2
                                                           --------->AHL20(2)
                                                       <-------TEIL
                                                      <------ZmHOX2a(2)
                                                     --------->RVE1(2)
                     --------->At4g35610             --------->ARR11(2)
                     <---------At4g35610             <---------ARR11(3)
                     --------->ZAT2                  --------->AGP1
                    --------->GLK1(2)                <---------ARR14(2)
            --------->YAB1                           --------->GATA12                        <------
           <---------YAB5                            --------->ARR11(3)        --------->ANAC46
       <---------RVE1(2)                             --------->ARR14(2)        --------->ANAC58
       <---------ARR11(3)                            <---------ARR11(2)        --------->ANAC58
>CBF   --------->ARR11(3)                            <---------GATA12  ----------->GT1       -------
 
agacgctggagataatcagcaagaagctgagagaagaagcgatgaaacagagtcgagatccattaaagaaccgaaggtaaacaagaaactgaacaagaac  10336000
                                                                                           <------ZmHOX2a(2)
                                                                                          --------->RVE1(2)
                                                                                         <------ZmHOX2a(1)
                                                                --------->DOF5.7(1)  ------>ZmHOX2a(1)
                                                           <------ZmHOX2a(1)         =============HOX2a_HOX2a
                                                          --------->LBD16        --------->ARR14(2)
                                                        <-----------RAV1(2)      <---------ARR11(2)
       <----------DOF2                             <---------KAN1  <----------ID1--------->GLK1(2)
---ARR11(3)              ----------->GT1----------->GT1 <---------LBD16          --------->ARR11(2)
-->ARR11(3)--------->WOX13(2)   --------->MYB52(1)------->TEIL---------->DOF2    <---------ARR14(2)
 
ttgccctgttctttaactatggattgtttcgaaaaaaacagagtcgataaacgaatttctcaggagaaagaagacgaagatgagaatcctcaggatcaaa  10336100
                                                                    --------->ATHB12
                                                                    <---------ICU4
                                                                   <---------YAB1
                                                                   <---------YAB5
                                                                 --------->YAB1          <---------YAB5
                  --------->ARR11(3)                             <---------ICU4         --------->GLK1(2)
                  <---------ARR11(1)                            <---------YAB5         <---------GLK1(2)
                  --------->GATA12        --------->GATA12      <---------YAB1------>ZmHOX2a(2)
                 <---------CCA1(2)        <---------GATA12     <---------ARR11(3)    <---------TOE2(3)
      --------->DOF5.7(1)                 --------->ARR11(2)   --------->ARR11(3)<----------DOF2
      <---------TOE2(3)                 ------>ZmHOX2a(2)     --------->YAB1--------->ARR11(3)    <-
    ---------->DOF2                 <---------YAB1           <---------YAB1 <---------ARR11(3)    --
 
tacagagcaaaggtagtttcaaatctttgagagaaccatatgatcgatctacggttttctacttatgatcatcatttgtgatctctttaagaatcgtatg  10336200
                                                                                                  --
                                                                                                 ---
                                                                                               <----
                                                                                            <-------
                                                                                           <--------
                                                                                           <--------
                    <---------GLK1(1)                                                    --------->ARR14(2)
                    <---------KAN1                                                 <---------ARR11(1)
                    --------->CCA1(2)                                              --------->ARR11(2)
                   <---------RVE1(2)                 --------->YAB5                <---------ARR14(2)
                   <---------ARR14(2)        <------MYB46(1)                       <---------ARR11(2)
         ------>ZmHOX2a(2)                 <---------ANAC46                        --------->RVE1(2)
       <---------GATA12                  <---------MYB46(3)                        --------->ARR14(2)
       --------->GATA12          <----------DOF2    <---------YAB1                <---------CCA1(2)
   <-------GAMYB   --------->ARR11(2) <-----------RAV1(1)                       --------->ANAC55(2)
  <-----------RAV1(1)          <---------YAB5<------MYB83                       <---------ANAC58 ---
--------GLK1(1)    --------->ARR14(2)<---------TOE2(3)           <---------KAN1 <---------ANAC55(2)
------->GLK1(1)    <---------ARR11(2)<---------RVE1(2)         <------ZmHOX2a(1)<---------ANAC58----
 
gatttctgttgatccaagtttggatatgtgtataatctttgatgttgttggtatgatgtttagagaggatgaggcagtcgagtccgtatccagttcgtcc  10336300
     --------->DOF5.7(1)
   ---------->DOF2
------->At5g28300                                                 --------->YAB1
------>LBD16                                                      --------->KAN1
-----LBD16                                                       <---------ATHB12
--SPL7(1)            --------->TOE1(3)                           <---------YAB5       <---------TGA1a
-ANAC58              --------->TOE2(3)                         --------->WOX13(1)     ==============
-ANAC58   <-----------HVH21                        --------->MYB111(1) ------>ZmHOX2a(1)    --------
-------->GT1      <-----------GT1     ---------->ID1     <---------ANAC58             --------->TGA1a
----->LBD16<---------MYB52(1)       <-----------RAV1(1)  <---------ANAC58--------->ANAC46   <-------
 
cggtaaaaaagactgtcagttttacctcaaaaatggtctgtgtcgctatagaagtagttgccgtttcaatcatcctactcaacgtccacaagtgagaact  10336400
<- Previous    Next ->

AGI:  At1g29560.1   
Description:  nucleic acid binding / zinc ion binding. similar to zinc finger protein-related [Arabidopsis thaliana] (TAIR:AT1G29570.1); similar to mCG120171 [Mus musculus] (GB:EDL00663.1); similar to PREDICTED: similar to hCG1642996 [Mus musculus] (GB:XP_909443.3); similar to PREDICTED: trichohyalin [Mus musculus] (GB:XP_001000857.2); contains InterPro domain Zinc finger, CCCH-type; (InterPro:IPR000571)
Range:  from: 10332357    to: 10335680    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
AGI:  At1g29570.1   
Description:  zinc finger protein-related. similar to nucleic acid binding / zinc ion binding [Arabidopsis thaliana] (TAIR:AT1G29560.1); similar to 17 kDa surface antigen [Parvibaculum lavamentivorans DS-1] (GB:YP_001412400.1); contains InterPro domain Zinc finger, CCCH-type; (InterPro:IPR000571)
Range:  from: 10335896    to: 10337840    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version