AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                 <---------AHL20(1)
                             <---------AHL20(2)
                             <---------AHL25(3)
                            --------->AHL25(1)
                            <---------AHL20(3)
                            --------->AHL20(3)
                            --------->AHL20(2)
                            <---------AHL20(1)                                       <---------DAG2
                            <---------AHL25(1)                                       <---------DOF5.7(1)
                            <---------AHL20(2)                                       <----------DOF2
                  --------->AHL25(1)                                              <---------ALFIN1
                  --------->AHL20(3)                                       --------->KAN4(2)
                  --------->AHL20(2)                                      <---------HSFC1(2)
          ------>ZmHOX2a(1) --------->AHL25(2)                            <----------TaMYB80
  --------->GLK1(2)         --------->AHL20(1)                            --------->HSFB2a(1)
  --------->ARR14(1)        --------->AHL25(3)                            <---------HSFB2a(1)
 --------->ARR11(3)       <---------WOX13(2)                              <---------KAN4(1)
 <---------GLK1(2)--------->AHL12(1)                                      <---------KAN1
 <---------ARR11(3)       --------->WOX13(2)                              --------->KAN4(1)
 <---------ARR14(2)   <-----------GT1             ----------->ARR10       --------->KAN1
 --------->ARR14(2)  <-----------GT1          --------->ZAT2              --------->HSFC1(2)
--------->YAB5    --------->AHL25(2)          <---------At4g35610        <---------KAN4(2)
--------->KAN1    <---------AHL25(2)          --------->At4g35610        ---------->TaMYB80
---------->ARR10  <---------AHL12(1)          <---------ZAT2           <------ZmHOX2a(1)
---------ATHB12   <---------AHL25(1)     <-----------GT1     <---------ALFIN1   ------>ZmHOX2a(1)
 
caaagattctctccttcccaattttttccaatttaatatgtttttttccagcttagtttctcccctactctcgaggaatattcctccacttttgccaaaa  8976000
                                                                                          <---------AHL12(1)
                                                                                         --------->AHL12(2)
                                                                                         <---------AHL20(3)
                                                                                         --------->AHL25(2)
                                                                                         <---------AHL25(2)
                                                                                         --------->AHL12(1)
                                                                                         <---------AHL12(2)
                                                                                  ----------->GT1
                                                                                ------->TEIL
                                                                             <---------YAB5
                                                                        --------->AHL12(2)--------->AHL12(1)
                                                                   --------->At5g28300  XXXXXXXXXXXX
                                                       <---------AHL20(1)    <---------YAB1
                                                       --------->AHL20(3)   <---------TOE2(3)
                                                       <---------AHL20(2)   --------->WOX13(2)
                                                       <---------AHL20(3)   <---------WOX13(2)
                                                       <---------AHL25(1) <---------AHL20(2)
                                                       <---------ARR11(3) <---------AHL25(3)
                                                       --------->ARR11(3)<---------AHL25(3)
                                                       --------->AHL25(1)--------->AHL25(1)
                                                       --------->AHL20(2)<---------AHL20(3)
                                       --------->CCA1(2)--------->KAN1 --------->WOX13(2)--------->AHL20(3)
                                      <---------RVE1(2)<---------AHL25(3)--------->AHL20(2)
                                     --------->YAB1    --------->AHL25(3)--------->AHL20(1)
                                    <---------YAB1     --------->AHL20(1)<---------AHL20(2)
                               --------->WOX13(2)      <---------AHL25(2)--------->AHL25(3)
                           ----------->GT1             --------->AHL25(2)<---------AHL25(1)
             <----------DOF2   <---------WOX13(2) --------->AHL20(2)   <---------WOX13(2)<---------AHL12(1)
       <----------DOF2 <---------AHL20(3)   <-----------GT1       ----------->GT1 --------->YAB5
    <---------ARR11(3) --------->AHL20(3)<---------YAB1--------->AHL12(1)<---------AHL25(2)     ----
 <----------DOF2  <---------YAB1 <---------AHL20(2)    <---------AHL12(1)--------->AHL25(2) <-------
 
acttctttatctttttcttttctgataaaaatgtaatttatgatatgataccatataatatattctaaactgtaaatttaatgaatgtttaaaattttct  8976100
                                                           <---------AHL12(1)
                                                           --------->AHL12(1)
                                                          <---------AHL25(1)
                                                          --------->AHL12(1)
                                                          --------->AHL25(2)
                                                          <---------AHL25(2)
                                                          <---------AHL12(1)
                                                          <---------AHL25(3)
                                                          --------->AHL12(3)
                                                          --------->AHL25(1)
                                                          <---------AHL12(2)
                                                         --------->AHL25(2)
    --------->ARR14(2)      --------->KAN4(2)            --------->AHL25(3)
    <---------ARR14(2)     <---------GLK1(1)             --------->AHL25(1)                   ------
    --------->ARR11(3)     --------->KAN1                --------->AHL12(3)                  <------
    <---------ARR11(3)    <---------RVE1(2)<---------MYB52(1)                               <-------
   <---------CCA1(2)      --------->ARR11(3)             --------->AHL20(2)  --------------->AGL15
 <---------ANAC55(2)      --------->ARR11(2)      <---------YAB1             <---------------AGL15
 --------->ANAC55(2)      --------->ARR14(2) <---------MYB46(3)             <-----------------AGL3
XXXXXXXX>MIR781   --------->YAB5 <<<<<<<<<TBF1 <---------YAB1 <-------TEIL  <-----------------AG ---
------->GT1       --------->RVE1(2) --------->ZAT14      <---------AHL25(2) <-----------------AGL1
----GT1 <---------YAB1    <---------ARR14(2) --------->MYB52(2)             <-----------------AGL2
 
ggttacatatcttgattccaatctctatggatattcttcttcactcgtttgttattacaaaaaaattcatgtgtatatttctaaaataggtagagaataa  8976200
                                                            <-----------HVH21
                                                            <-----------TGA1
                                                           --------->ANAC46            <---------ZAT2
                                                           --------->bZIP60(2)         <---------At4g35610
                                                         <---------DOF5.7(2)           --------->ZAT2
                                                        <---------WRKY12               --------->At4g35610
                                                       --------->DOF5.7(2)  <---------bZIP60(1)
                       --------->YAB5                 <-----------TGA1      <---------TGA2(1)
     ---------->DOF2  <---------YAB5                  --------->TOE1(3)     --------->bZIP60(1)
     --------->DOF5.7(1)                        --------->TOE2(3)           --------->TGA2(1)
--->MYB52(1)          --------->ICU4         <---------CCA1(2)         <---------At4g35610
---KAN1             <---------ICU4    ---------->ID1  --------->TOE2(3)--------->At4g35610
--KAN4(2)---------->DOF2              <---------YAB5 --------->ANAC46  --------->YAB5 ------>NtERF2
---->GAMYB --------->DOF5.7(1)  --------->YAB5--------->RVE1(2) <---------YAB1 <---------ICU4     <-
 
ccgaagaaaaaagaaagagttagtaatgactaaaatgactcgtcgttcttatctcaacgtcaacgtcatgagaatgctgacatcatcgccagctcgatag  8976300
                              --------->KAN1
                              --------->KAN4(1)
                              <---------KAN1
                              <---------KAN4(1)
                              <----------TaMYB80
                              --------->HSFB2a(1)
                              <---------HSFB2a(1)
                             <---------ARR14(2)
                             <---------KAN4(2)
                             ---------->TaMYB80
                             --------->ARR14(2)
                           --------->LBD16
                          --------->LBD16
                         --------->LBD16
                     --------->RVE1(2)
                     --------->ARR14(2)
                     <---------ARR14(2)
                     <---------ARR11(2)                                                           <-
                     --------->ARR11(2)                                                           --
                    <---------KAN1                                                                --
                    --------->KAN1                                                                <-
                    --------->GLK1(1)                                                             --
                    <---------GLK1(1)                                                       --------
             <---------ARR14(2)--------->KAN4(2)                                <-----------GT1  ---
             --------->ARR14(2)--------->ARR14(2)    --------->TOE1(3)   <---------At5g28300--------
     --------->DOF5.7(1)<---------LBD16         <---------MYB52(2)  ----------->TBP  <----------DOF2
   ---------->DOF2  <---------CCA1(2)     --------->RVE1(2)       ------>ZmHOX2a(1) <---------DOF5.7(1)
--------KAN1 --------->ARR11(2)<---------ARR14(2)    --------->TOE2(3)  <-----------GT1     --------
 
aatatggaaaggaaggaatccacatatccccgaatattctccctgtatcaaacaaacctcagcctattcctatatttaccattctaccctttcccaagta  8976400
                                        --------->ANAC58
                                        <---------ANAC55(2)
                                        --------->ANAC46
                                        --------->ANAC55(2)
                                     <---------SPL7(1)
                                   --------->MYB59
                                   <---------TOE2(3)
                           <-------TEIL<-------TEIL
                          --------->CCA1(2)
                          --------->ARR14(1)
                          --------->GLK1(2)
      --------->AHL25(1) --------->ARR11(1)        <---------ALFIN1
      <---------AHL25(3) <---------GATA12         ----------->HVH21
      --------->AHL12(1) <---------GLK1(2)       --------->DEAR3(2)
     <---------KAN1      --------->ARR14(2)   ------>NtERF2
     --------->AHL20(2)  --------->GATA12    --------->DEAR3(1)
  --------->LBD16        <---------ARR11(2)  <---------DEAR3(1)
--------GATA12           --------->ARR11(2) --------->ATERF1(1)            <----------DOF2
------->GATA12          --------->KAN1--------->CCA1(2)                   <---------DOF5.7(1)
------->ARR14(2)        <---------HSFB2a(1) --------->RAP2.6(3)          ------>ZmHOX2a(1)
--------ARR14(2)        --------->HSFC1(2)--------->ANAC46           --------->ARR11(2)
------->RVE1(2)        ----------->ARR10--------->ANAC58             ------>MYB46(1)  <----------DOF2
--->GT1             *TSS<---------HSFC1(2)----------->HVH21          <---------ARR14(2)
------>KAN1   <---------YAB5   <----------DOF2<---------DEAR3(2)     ------>MYB83 ------>NtERF2
->ANAC58--------->RVE1(2)<---------ARR14(2)<---------ATERF1(1)       --------->ARR14(2)
->ANAC58<---------GATA12--------->HSFB2a(1)--------->MYB52(1)      --------->AtMYB61 <---------DOF5.7(1)
 
aaatccgaataaatctaaacatcaagaagattcggttttaggtacgcgacggcccgacctcgattagacaccaatcctctttctctgccctttaaaactt  8976500
                                                                                    --------->ARR11(2)
                        =========================HOX2a_HOX2a                        <---------ARR11(2)
                        <----------DOF2   <------ZmHOX2a(2)                      <---------ANAC58
                    <-----------GT1      --------->ARR11(2)                      <---------ANAC58
                   --------->KAN1        --------->GATA12                        --------->ANAC55(2)
                   <-----------GT1       --------->AGP1                   <---------TOE2(3)
            ---------->DOF2              <---------ARR11(2)           --------->GATA12<------------AtMYB77
         --------->TOE2(3)               --------->RVE1(2)            --------->ARR11(3)
        <----------ID1  ------>ZmHOX2a(1)<---------GATA12             <---------ARR11(3)--------->At5g28300
 
ccaacttaaaaacgtcaaagttttatcctttctctctcattttagatccaaaactcttctctgtctctctcaagatttatgttttcgtaactgtaactca  8976600
                            -------->HAHB4
                            --------->YAB5
                            --------->YAB1
                            <---------ICU4
                           <---------YAB1
                           <---------YAB5
                           --------->ICU4
                         <---------ICU4
                         --------->YAB1
                        --------->ICU4
                      --------->YAB1
                 ------>ZmHOX2a(2)
                <------ZmHOX2a(2)
               <---------GATA12
               <---------AGP1
               <---------ARR11(3)                                                     <---------KAN1
               --------->RVE1(2)                 <---------ANAC46                    --------->ARR14(2)
               <---------ARR14(2)                <---------bZIP60(2)                 <---------ARR14(2)
               <---------RVE1(2)              ----------->HVH21                   --------->ANAC58
               --------->AGP1 <---------YAB1 <-----------HVH21 --------->LBD16<-----------HVH21    <
               --------->ARR14(2)            --------->At5g28300             <---------bZIP60(1)   <
               --------->ARR11(3)           ----------->GT1 --------->ANAC46 --------->bZIP60(1)----
               --------->GATA12            <---------DEAR3(1) --------->HSFB2a(2) --------->ANAC58 -
 
tagcaaaaacgagtctaagatctgttcataatgatgatgttcaagagcggtgacatggattacacccagaaaatgaagagatgtcacgaatatgtagaag  8976700
                                                  --------->YAB5
                                             <---------DAG2
                                             <----------DOF2
                                             <---------DOF5.7(1)
       <----------ID1                       <---------DOF5.7(1)
     >>>>>>>>>TBF1                     <---------ZAT2                                       <-------
---------HSFC1(1)--------->DOF5.7(1)   --------->ZAT2   --------->ARR11(3)                 <--------
---------HSFB2a(2)   <-------TEIL      --------->At4g35610                           --------->KAN1
----->ARR11(3) ---------->DOF2    --------->O2   <---------YAB1                  <-----------GT1 <--
-------->HSFB2a(2)  --------->CCA1(2)  <---------At4g35610                 ----------->GT1------>ZmHOX2a(1)
 
ctctagaagaagaacaaaaaaagattcaagtctttcaacgtgagctccctttatgtttagaacttgtaacccaaggtaatgttattacacatcctctttt  8976800
    --------->KAN1
   --------->AHL20(1)
   --------->ARR11(3)
   <---------ARR11(3)
  --------->AHL12(3)
  <---------AHL20(2)
  <---------AHL12(3)                                                                           <----
--------->AHL25(1)                             --------->ANAC55(2)                            <-----
--------->AHL12(3)                     <---------WOX13(2)                          <------ZmHOX2a(1)
<---------AHL12(3)     ------>ZmHOX2a(2)<---------YAB5<---------YAB1         <<<<<<<<<<AtTINY2------
---DOF2               <------ZmHOX2a(2)--------->WOX13(2)                    --------->ETT(1) ------
-DOF5.7(1)---------->ID1           --------->TOE2(3)--------->YAB5        <---------O2       <------
-------RVE1(2)   <-----------GT1<---------GLK1(2)  <---------YAB1         --------->O2  --------->MYB52(1)
 
gatatatatattcttcgttttcacgatcgcttccagtttcttaattgtttacatatcattcttgtagctatcgagtcatgtcggaaggagttatcggaat  8976900
<- Previous    Next ->

AGI:  At1g25550.1   
Description:  myb family transcription factor. similar to myb family transcription factor [Arabidopsis thaliana] (TAIR:AT1G68670.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO42100.1); contains InterPro domain Homeodomain-related; (InterPro:IPR012287); contains InterPro domain Homeodomain-like (InterPro:IPR009057); contains InterPro domain Myb, DNA-binding (InterPro:IPR014778); contains InterPro domain Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447)
Range:  from: 8976421    to: 8978080    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version